Supercharge Your Innovation With Domain-Expert AI Agents!

Using the p5126-zmms1d construct to create a maize dominant male sterile line and its application method for breeding and production

A technology of nuclear sterile lines and constructs, applied in the fields of application, botany equipment and methods, biochemical equipment and methods, etc., can solve problems such as unstable purity, difficulty in application, and susceptibility to environmental influences

Active Publication Date: 2020-09-01
BEIJING SHOU JIA LI HUA SCI TECH CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These methods have many disadvantages, such as high cost, unstable purity, and susceptibility to environmental influences, which restrict the application efficiency of heterosis in the actual production of corn.
[0005] Maize dominant male sterile materials do not have the problem of detasseling, but due to the lack of effective maintenance and reproduction techniques, it is difficult to apply them in actual production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Using the p5126-zmms1d construct to create a maize dominant male sterile line and its application method for breeding and production
  • Using the p5126-zmms1d construct to create a maize dominant male sterile line and its application method for breeding and production
  • Using the p5126-zmms1d construct to create a maize dominant male sterile line and its application method for breeding and production

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Construction of dominant sterility vector p5126-ZmMs1D

[0033] 1. Construction of pT5126-ZmMs1Ocs vector (contains p5126-ZmMs1 dominant sterility element, expression cassette SEQID NO.1)

[0034] Genomic DNA was extracted from the maize inbred line B73 with the PlantGen DNA Kit Plant Genomic DNA Extraction Kit (Kang Wei Century Company). Using the obtained genomic DNA as a template to amplify the 5126 promoter fragment, the primers used are as follows:

[0035] Oligo01: 5'-gaattcatctttctgatttcaaccat (GAATTC is the EcoRI restriction site);

[0036] Oligo02: 5'- gccgcggccgccgccggtcatggatccgggccccgcaa

[0037] agcaactttgatttg (GCGGCCGC is the NotI restriction site).

[0038] The 1.5 kb fragment of the amplified product, namely the 5126 promoter, was ligated into the pEASY-T5 vector, and the obtained vector was named pT5126.

[0039] RNA was extracted from maize inbred line B73 and amplified by reverse transcription PCR ZmMs1 gene, get 650 bp ZmMs1 Gene ...

Embodiment 2

[0064] Example 2: Application of dominant sterility vector p5126-ZmMs1D

[0065] 1. Obtaining dominant sterility transgenic lines through Agrobacterium-mediated genetic transformation of maize

[0066] Referring to the AN (Methods in Enzymology (1987) 153:292-305) method, the dominant nuclear sterile vector p5126-ZmMs1D constructed in the present invention was transformed into Agrobacterium EHA105 (Hood et al., Transgenic Res (1993) 2: 208-218), after identification, the positive strains obtained by transformation were selected for Agrobacterium-mediated maize genetic transformation, and the strains used were preserved in the General Microbiology Center (CGMCC) of the China Committee for the Collection of Microbial Cultures. The classification is named "Escherichia coli (Escherichia coli)", and the inventor named it "p5126Ms1D"; preservation address: No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing; preservation date: September 14, 2018 ; Deposit number: CGMCCNO.16...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a corn dominant genic male sterility line which is prepared from a construct containing p5126-ZmMs1 and DsRed genes through a biological technological approach and a technological method thereof applied to cross breeding and producing corn seeds. The construct is guided into a corn cell, a callus tissue or an organ to be applied to preparing transgenic corn dominant genic male sterility line seeds; under normal light (white light or sunlight), the transgenic sterility line seeds are light red; when being observed through a red fluorescence filter under green excitationlight, the transgenic sterility line seeds show stronger red fluorescence, and non-transgenic fertile seeds show normal corn color and have no fluorescence. The corn dominant nuclear genic sterility line disclosed by the invention has qualitative difference from a corn recessive male sterility technology (namely a corn multi-control sterility technology system) which has been already applied for authorization by the team, can be efficiently applied to corn sterility cross breeding and hybrid seed production and has great agricultural production application value.

Description

technical field [0001] Generally, the present invention relates to the fields of molecular biology and plant genetic engineering and crop breeding. Specifically, the present invention relates to the use of p5126-ZmMs1 and DsRed The gene construct is used to create a dominant nuclear male sterile line of corn, and the seed of the male sterile line of corn produced thereby is applied to the technical method of hybrid breeding and seed production. Background technique [0002] Heterosis is the phenomenon in which a hybrid is superior to its two parents in one or more traits. For example, the first generation of hybrids obtained by crossing different strains, different varieties, or even different species often show stronger growth rate and metabolic functions than their parents, resulting in developed organs, increased body size, and increased yield, or manifested in Improvement of disease resistance, insect resistance, stress resistance, viability, fecundity, viability, et...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82C12N15/65C12N5/10A01H1/02A01H5/00A01H5/10A01H6/46
CPCA01H1/02C12N15/65C12N15/8231C12N15/8289
Inventor 万向元张丹凤谢科吴锁伟安学丽张煜文侯全璨刘欣洁李金萍
Owner BEIJING SHOU JIA LI HUA SCI TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com