Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

dsRNA and application thereof in pest control

A DNA molecule, insect technology, applied in the field of biological control, can solve problems such as hatching rate differences

Active Publication Date: 2019-08-09
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that the developmental state of the next generation of locust eggs is closely related to the maternal effect. The mother migratory locusts with different light treatments can convert light signals into proteins, secondary metabolites and other substances and pass them on to the next generation of locust eggs, eventually resulting in a higher hatch rate. difference

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • dsRNA and application thereof in pest control
  • dsRNA and application thereof in pest control
  • dsRNA and application thereof in pest control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Embodiment 1, the synthesis of dsRNA and its application in the prevention and control of migratory locusts

[0080] 1. Synthesis of dsRNA

[0081] Using T7RiboMAX TM The Express RNAi System Kit synthesizes dsRNA. Specific steps are as follows:

[0082] 1) Preparation of recombinant plasmid

[0083] 1-1) Using migratory locust cDNA as a template, PCR amplification is performed with primers 1F / 1R and 2F / 2R to obtain a PCR product.

[0084] 1F: ACCTGTTGCTGCTTGATGTC;

[0085] 1R: GCCTTCTGTTTCTCGTCCTC.

[0086] 2F: AATGTCTGTCGTTCCTGCC;

[0087] 2R: TTCTCTCTCCTCCCTGCTGT.

[0088] The PCR reaction system is as follows (total volume 50 μL): cDNA template 1 μL, dNTP 4 μL, 10×Buffer 5 μL, pre-primer 1 μL, post-primer 1 μL, Taq enzyme 0.25 μL, ddH 2 O 38 μL.

[0089] The PCR reaction conditions are as follows: 95°C for 3min; 35 cycles of 95°C for 30s, 55°C for 30s, and 72°C for 1min and 30s; 72°C for 10min; and storage at 4°C.

[0090] 1-2) Perform electrophoresis of t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses dsRNA and application thereof in pest control. The dsRNA is double-stranded RNA composed of nucleotides shown as a sequence 7 in a sequence table and nucleotides shown as reverse complementary sequences. Experiments prove that the dsRNA is introduced into a migratory locust by applying an injection method, the diapause rate of eggs of the migratory locust is remarkably reduced compared with the control. A theoretical basis is provided for further understanding a migratory locust diapause mechanism and creating a new biopesticide preparation.

Description

technical field [0001] The invention belongs to the technical field of biological control, in particular relates to a dsRNA and its application in pest control, in particular to a dsRNA and its application in migratory locust control. Background technique [0002] Locust is a major agricultural pest in the history of our country. It has the characteristics of various types, great influence, and frequent outbreaks. The scope and severity of its occurrence often cause great losses to our national economy, especially in agricultural production. In recent years, with the increasing trend of global warming, high-density locust swarms have occurred from time to time, and the risk of long-distance migration has intensified, seriously threatening the grain production in my country's main agricultural production areas. Traditional pest control is mainly based on emergency control and chemical control. , relying too much on chemical pesticides for pest control, there is an urgent need ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113A01N57/16A01P7/04
CPCC12N15/113A01N57/16C12N2310/14
Inventor 涂雄兵张泽华陈俊郝昆崔栋楠王广君农向群赵亚斋
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com