Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of Du pear salt tolerance gene, protein and recombinant vector and application

A salt-tolerant gene and gene technology, applied in the field of genetic engineering, can solve problems such as self-incompatibility, inability to obtain high-quality varieties efficiently, and long growth cycle

Active Publication Date: 2022-04-12
NANJING AGRICULTURAL UNIVERSITY
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Pear is a perennial woody fruit tree belonging to Rosaceae, which has a long growth cycle and self-incompatibility. Therefore, traditional breeding methods cannot efficiently obtain excellent varieties.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of Du pear salt tolerance gene, protein and recombinant vector and application
  • A kind of Du pear salt tolerance gene, protein and recombinant vector and application
  • A kind of Du pear salt tolerance gene, protein and recombinant vector and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Cloning of full-length cDNA of PbbHLH67 gene in Duli pear

[0036] Using an efficient yeast expression system, a basic helix-loop-helix transcription factor PbbHLH67 was screened from Du pear, and primers were designed according to the sequence of the PbbHLH67 gene (SEQ ID NO.3: ATGGAGAATGATTTTTTCCTAAATGC, SEQ ID NO.4: GAGCTCAATTTTCATGTGCGATAC), The full length of Du pear was amplified by RT-PCR method. The detailed steps are as follows: 1 μg of Du pear RNA was treated with 1 U of DNaseI at 37°C for 30 minutes and immediately placed on ice, and 1 μL of 50mM EDTA was added and treated at 65°C for 10 minutes and immediately placed on ice. The synthesis of the first strand of cDNA was carried out according to the operation manual of Quanshi Gold Reverse Transcription Kit. The resulting first-strand cDNA was used for amplification of the PbbHLH67 gene. PCR was completed according to the following procedures: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 ...

Embodiment 2

[0040] qRT-PCR analysis of PbbHLH67 gene under different stress conditions

[0041] In order to analyze the response pattern of PbbHLH67 gene to low temperature, ABA, high salinity and drought in Duli pear, the expression pattern of PbbHLH67 gene was analyzed using Real-time PCR technology. The RNA was extracted by the CTAB method, and the synthesis of the first strand of DNA was carried out according to the operation manual of the TOYOBO reverse transcription kit. In a 20 μL reaction system: 10 μL 2×Mix, 0.1 μL cDNA, 5 μL primers (Tubulin as internal reference primer (SEQ ID NO.7: TGGGCTTTGCTCCTCTTAC, SEQ ID NO.8: CCTTCGTGCTCATCTTACC), length 208, 4.9 μL water) . The primers designed for the PbbHLH67 gene include:

[0042] SEQ ID NO.5: CCCCTTGGATAATACCTCCACC;

[0043] SEQ ID NO. 6: TTCACCAAATGCTGGAAACTG.

[0044] The program of quantitative PCR was: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 3 s, annealing at 60°C for 10 s, extension at 72°C for 30 s, 45...

Embodiment 3

[0047] Subcellular localization of the gene encoding PbbHLH67

[0048] According to the PbbHLH67 nucleotide sequence and the pJIT166-GFP vector map, XbaI and BamHI restriction sites were added before and after the gene sequence. The target gene extraction plasmid with correct sequencing results was used as a template, and amplified with primers (SEQ ID NO.9 and SEQ ID NO.10) with added restriction sites. The PCR program used was: 94°C pre-denaturation for 3 minutes; 94°C denaturation 30s, annealing at 58°C for 60s, extension at 72°C for 90s, 35 cycles; extension at 72°C for 10min. The stop codon TAG was removed from the 3' of the gene in order to allow the expression of the gene as a fusion with GFP. After the PCR product was subjected to 1% agarose gel electrophoresis, the target band was recovered using a gel kit. The pJIT166-GFP vector plasmid was digested with XbaI and BamHI restriction endonucleases, purified and recovered after digestion at 37°C for 4 hours. The diges...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a Du pear salt-tolerant gene, protein, recombinant vector and application, and relates to the technical field of genetic engineering. The sequence of the salt tolerance gene PbbHLH67 of the present invention is shown in SEQ ID NO.1. The present invention constructs an overexpression vector and a silencing vector for the gene, respectively makes it stably inherited in Arabidopsis thaliana and transiently transformed and expressed in Pear pear through genetic transformation mediated by Agrobacterium, and performs salt tolerance function on the obtained positive plant seedlings verify. The results showed that PbbHLH67 gene can effectively increase the salt tolerance of plants. The discovery of this gene provides new genetic resources for plant stress-resistant molecular breeding, provides a reference for plant cultivation in saline-alkali land in my country and the world, and is conducive to improving the utilization rate of saline-alkali land in my country.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a salt-tolerant gene, protein, recombinant carrier and application of Duli pear. Background technique [0002] As one of the main fruit trees in the world, pear is second only to apples and citrus in China in its planting area and output, and its export volume accounts for the first in the world. It is an important fruit tree economic crop in my country. There are rich varieties of pears in my country, mainly involving white pears, western pears, sand pears, and Qiuzi pears, which are mostly distributed in North China, Northeast China, Northwest China and the Yangtze River Basin. Among them, white pears, sand pears, and Qiuzi pears are all native to China. my country is one of the birthplaces of the center of the genus Pear. Because of its extensive cultivation area, pears are often affected by environmental factors during the growth and development proces...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82C12N15/11C07K14/415A01H5/00A01H6/20A01H6/74
CPCC07K14/415C12N15/8273
Inventor 黄小三董慧珍王春孟乔清海张绍铃陈启明马明陈紫龄谢智华吴巨友齐开杰陶书田
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products