Pear drought-inducible transcription factor pbrwrky53 and its application in improving plant drought resistance

A drought-inducing, transcription factor technology, applied in the field of plant genetic engineering, can solve the problem of no pear drought resistance and other problems

Active Publication Date: 2020-07-07
NANJING AGRICULTURAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no research report on genes related to drought resistance in pears

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pear drought-inducible transcription factor pbrwrky53 and its application in improving plant drought resistance
  • Pear drought-inducible transcription factor pbrwrky53 and its application in improving plant drought resistance
  • Pear drought-inducible transcription factor pbrwrky53 and its application in improving plant drought resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Cloning of full-length cDNA of pear PbrWRKY53 gene

[0051] A drought-induced transcription factor PbrWRKY53 was screened by screening pear full-length cNDA library, and primers were designed according to the sequence of PbrWRKY53 gene and Primer premier 5.0, and its full-length was amplified from Du pear by RT-PCR. The detailed steps are as follows:

[0052] The research material Du pear was planted in the National Pear Engineering Center of Nanjing Agricultural University, and its seedling age was 65 days. Select the vigorously growing Du pear seedlings, weigh 0.3g samples at random, and immediately freeze them with liquid nitrogen. RNA was extracted by CTAB method, the specific method is as follows:

[0053] Preparations before the experiment: Use 10% DEPC water to treat various pipette tips, 1.5mL centrifuge tubes, 2mL centrifuge tubes, 50mL cryotubes, mortars and pestles. The required experimental supplies should be processed for more than 12 hours in advance, s...

Embodiment 2

[0062] qRT-PCR analysis of drought-induced transcription factor PbrWRKY53 gene in pear under different stress conditions

[0063] In order to analyze the effect of PbrWRKY53 gene on dehydration ( figure 2 A), low temperature ( figure 2 B) and abscisic acid ( figure 2 C) Response mode, using Real-time PCR technology to analyze the expression mode of PbrWRKY53 gene. The RNA was extracted by the CTAB method, and the synthesis of the first strand of cDNA was carried out according to the operation manual of the TOYOBO reverse transcription kit. In the 20μl reaction system, there are: 10ul 2×Mix, 0.1ul cDNA, 5μl primer (using ubiqutin as the internal reference primer, the length is 208), 4.9ul water. The procedure of quantitative PCR is as follows:

[0064] Table 1 Quantitative PCR program

[0065]

[0066]

[0067] When dehydrating plants, such as figure 2 As shown in A, the transcription level of the PbrWRKY53 gene gradually increased after the plants were dehydrat...

Embodiment 3

[0069] Subcellular localization of drought-induced transcription factor PbrWRKY53 in pear

[0070] According to the nucleotide sequence of the PbrWRKY53 gene and the pJIT166-GFP vector map, NCOI and BSTPI restriction sites were added before and after the gene sequence. The sequence of the restriction site is as follows:

[0071] NCOI: CCATGG

[0072] BSTPI: GGTGACC

[0073] The target gene extraction plasmid with correct sequencing results was used as a template and amplified with primers added with restriction sites. The PCR program used was: pre-denaturation at 94°C for 3 minutes; denaturation at 94°C for 30 seconds, annealing at 58°C for 1 minute, and extension at 72°C for 1 minute and 30 seconds. 35 cycles; 72°C extension for 10 min. The primer sequences of the restriction sites are as follows:

[0074] D-F1: GG CCATGG CTCAGCTTACCCTTCTCACAAATCTG (SEQ ID No. 5)

[0075] D-R1: TT GGTGACC CCTCACCCTTCTGTGTTGTGGGAGCC (SEQ ID No. 6)

[0076] The stop codon TAG was remo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a pear drought induction transcription factor PbrWRKY53 and application thereof in aspect of increasing drought resistance of a plant, and belongs to the technical field of plant genetic engineering. A nucleotide sequence of the pear drought induction transcription factor PbrWRKY53 is as shown in SEQ ID No.1, and an amino acid sequence of protein encoded by the pear droughtinduction transcription factor PbrWRKY53 is as shown in SEQ ID No.2. Overexpression of the pear drought induction transcription factor PbrWRKY53 is capable of effectively enhancing active oxygen removing capacity of a transgenic plant, so that the drought resistance of the plant is increased; according to record of embodiment parts, compared with a control wild type plant, the drought resistance of a transgenic overexpression plant system of tobacco and pyrus ussuriensis is greatly promoted.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, in particular to pear drought-induced transcription factor PbrWRKY53 and its application in improving plant drought resistance. Background technique [0002] Pear is one of the main cultivated economic fruit tree species in the world today. China is one of the important origins of pears and is the largest country in the world in terms of pear production. The layout and planning of my country's pear-producing areas have greatly promoted the rapid development of the pear industry. Because pear-producing areas are widely distributed in my country, the growth and development of pear trees are easily affected by factors such as geography and climate conditions, such as drought, Freezing damage, salinity, etc. Therefore, cultivating stress-resistant new varieties with strong stress resistance and good comprehensive traits has become a crucial factor for the development of the pear in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/84A01H5/00A01H6/82A01H6/74
CPCC07K14/415C12N15/8273
Inventor黄小三刘月顾冰洁林泽崑邢才华张绍铃李凌胡轼赵梁怡董慧珍高俊芝
OwnerNANJING AGRICULTURAL UNIVERSITY