Unlock instant, AI-driven research and patent intelligence for your innovation.

Modified plants

a technology of modified plants and pollen, applied in the field of modified plants, can solve the problems of increasing individual seed weight and perhaps total yield, increasing total yield, and extra doses of these genes, and achieving the effect of preventing the escape through pollen

Inactive Publication Date: 2006-06-22
UNIVERSITY OF BATH
View PDF23 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0049] As will be described herein, modulation of imprinting of plant gamete DNA can be used after endosperm development. The effects can be applied to male or female gametes of the transformed plant. Thus, in a second aspect, the present invention provides a method for the production of modified endosperm which comprises the step of transforming a plant, or plant propagating material, with a nucleic acid molecule comprising one or more regulatory sequences capable of directing expression within the developing gynoecium, especially the cell lineage that gives rise to the female germ line (megasporocyte tissue), within the ovule of the resultant plant and one or more sequences whose expression or transcription product(s) is / are capable of modulating genomic imprinting.
[0053] If the homologs of proteins in the C-met binding complex in plants are likewise involved in uniparental gene silencing (imprinting) then inactivation of these genes in the maternal or paternal germ lines would be predicted to mimic the uniparental inactivation of the genes responsible for methylation. In addition, there could be a cumulative effect if more than one gene is inactivated. If for instance inactivation of the MET1 gene by antisense transcription or ds-RNA in one of either germ lines is not complete, then introduction of an additional vector causing inactivation of one of the other components of the imprinting machinery will enhance the effect.
[0059] 1. To provide for removal of imprinting in a single sex of gamete within an individual plant. This will produce the asymmetry of imprinting that is required to mimic the interploidy cross effect in a self-fertilizing plant.
[0061] 3. To prevent the attenuation of the interploidy cross effect due to the expression of the hypomethylation gene (Met1as) within the endosperm. Crosses between two 2xMet1as plants result in seed with a slightly increased number of endosperm nuclei and normal seed weight (Table 1), which is most easily explained by proposing that the combination of hypomethylated gametes of both sexes allows normal endosperm development.
[0071] In one specific embodiment, the degree of methylation is increased. This can readily be achieved by incorporating one or more sequences encoding one or more methylating enzymes into the transgene.
[0089] In a preferred embodiment of the seventh aspect, the degree of nucleic acid methylation is decreased. An eight aspect of the present invention provides the use of a transgene in which the degree of nucleic acid methylation is decreased, as a post-fertilization barrier to hybridization, for example, interspecific or intraspecific hybridization between plants.

Problems solved by technology

Therefore, in monocotyledons increasing the size of the endosperm or its ability to accumulate storage products is likely to increase individual seed weight and perhaps total yield.
Consequently, increasing individual seed size may not result in an increase in total yield.
Seed quality is an important factor in the cost of production of commercial seed lots since these must be tested before sale.
Extra doses of these genes also have dramatic effects on embryo size.
However, the ability to make successful sexual crosses is frequently restricted to closely related species because of the existence of a variety of pre-fertilization and post-fertilization reproductive barriers (see Stoskopf, Tomes and Christie, 1993).
One type of post-fertilization barrier is associated with poor or disrupted endosperm development (post-fertilization endosperm development barrier), which results in non-viable seed (see Ehlenfeldt and Ortiz, 1995).
Endosperm failure in unsuccessful crosses is due to the operation of a genetically determined system known as endosperm dosage (Haig and Westoby, 1991).
The removal of the endosperm dosage barrier to sexual interspecific hybridization would have economic benefits, since non-sexual techniques for hybridization e.g. somatic hybridization are costly and difficult.
The occurrence of successful intra- and interspecific hybridization can also be problematic.
In particular, hybridization between genetically modified crop plants and non modified cultivated or wild plants thereby creating hybrids carrying transgenes with the potential for environmental and other damage inherent in this form of “transgene escape”, has caused alarm within the public and the regulatory authorities.
For example, the complete elimination of flowering is acceptable in vegetable crops and forage grasses during the ‘cropping stage’, but unless this trait is conditional in some way, the production of seed by the seed producer, or the breeding of new varieties by the plant breeder, is rendered difficult or impossible.
Whilst this the implementation of this solution would ‘only’ require modifications to flower design, such as approach might be criticized on the grounds that pollen could escape from damage flowers.
However, in the case of inter-specific hybridization, a successful outcome—viable hybrid seed—is usually only possible between closely related species.
Hence a cross between plants of the same ploidy may fail because the relative genomic strengths of their respective genomes result in a lethal effective genomic imbalance within the hybrid endosperm.
In summary, the failure of intraspecific (interploidy) crosses and crosses between species may have a common cause—a genomic imbalance within the endosperm mediated by genomic imprinting.
Currently, F1 hybrid seed is produced annually by hybridizing two genetically distinct parents in a labor intensive and costly process.
A potential problem in the development of apomictic crop species, given this likely dependency on ‘sexual endosperms’ (formed by fertilization), is ensuring the successful development of the endosperm, since the endosperm is required to nourish the embryo or itself represents the principal economic harvest.
One barrier to endosperm development is the endosperm dosage system.
Deviation from this ratio results in endosperm abortion and seed lethality (Haig and Westoby, 1991).
Solutions involving fertilization of the polar nuclei are likely to complicate the delivery of apomixis, for example by necessitating the introduction of a mechanism to prevent fertilization of the “egg” or the need to devise ways to produce 2n male gametes, or by some other means ensure a 2:1 genomic ratio.
Extensive screening efforts in Arabidopsis met with limited success having identified several mutant genes that condition only limited endosperm development in the absence of fertilization (Ohad et al., 1996; Chaudhury et al., 1997; Ohad et al., 1999; Kiyosue et al., 1999; Luo et al., 1999).
One potential explanation is that these mutations trigger endosperm development but do not overcome the effects of the endosperm dosage system.
Repeated self pollination of ddm mutant plants does however result in the appearance of severe developmental abnormalities (Kakutani et al., 1996).

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modified plants
  • Modified plants
  • Modified plants

Examples

Experimental program
Comparison scheme
Effect test

example 1

The Use of Gametes from Hypomethylated Plants (Met1as and ddm) Mimics the Interploidy Cross Effect (Alters Number of Endosperm Nuclei Formed and Consequently the Weight of Mature Seed)

[0115] Reciprocal interploidy (different ploidy) crosses between diploid (2x), and tetraploid (4x) (Scott et al., 1998) or hexaploid (6x) (Scott et al., 1998) Arabidopsis plants result in changes to both the size of the endosperm, in terms of the number of endosperm nuclei and volume of the chalazal endosperm, and to the dry weight of mature seeds (see Table 1) and the viability of the seed (Table 1). This is the interploidy cross effect.

Crosses Involving Met1as Plants

[0116] Intraploidy (same ploidy) crosses between 2x Met1as plants and 2x wild type plants mimic this effect (see Table 1 and FIGS. 1 and 3). A cross between a 2x Met1as plant as seed parent and a 2x wild type plant as pollen parent produces seeds with an average of 450 endosperm nuclei (an increase of 130% over 2xmet-2xmet cross), a r...

example 2

Construction of Expression Cassettes that Restrict Gene Expression to Either the Gynoecium or the Stamen

[0125] Example 1 demonstrates that uniparental demethylation can be used to control seed size. However, the increase in seed weight in the cross 2xmet1a / s-2x is smaller than for the corresponding interploidy cross (2x-4x). This may be due to the reduced fitness of the 35SMet1as female lines since demethylation is approximately constitutive. In order to reduce and eliminate this effect and to allow seed size changes to be obtained in a single plant it is necessary to restrict demethylation as much as possible to the germ line or gametes.

[0126] a. Designing a general female-germ line specific expression vector

[0127] An expression vector based on the female-specific AGL5 promoter (Sessions et al. (1998)) is constructed as described below. The nos polyA signal sequence is excised from pCaMVNEO (Fromm et al. (1986)) as a BamHI, Hind III fragment and cloned between the BamHI and Hind...

example 3

Construction of Chimaeric Gene Fusions Between the Female (Example 2a) and Male (Example 2b) Germ-line Specific Cassettes and the Met1 Antisense Gene

[0131] Expression of the MET1 gene can be reduced in the female or male germ lines by employing techniques known in the art. For example MET1 down-regulation can be achieved by expressing antisense MET or antisense MET1 fragments or sense MET1 or partial sense MET1 or ribozymes directed against MET1 or combination of the preceding, from promoters expressed in the required germ-line. Below is an example of an antisense MET1 approach.

[0132] a) The construction of a female germ-line specific Met1as gene

[0133] The MET1 cDNA is 4.7 kb long and is isolated by RT-PCR from Arabidopsis cDNA using the primers MET1F and MET1R.

5′ACTCGAGATTTTGAAAATGGTGGAAAATGGGGC 3′MET1F(SEQ ID NO:5)     XhoI5′ACCCGGGTGGTTATCTAGGGTTGGTGTTGAGGAG 3′MET1R(SEQ ID NO:6)     SmaI

[0134] The resulting MET1 PCR fragment is then cloned as a SmaI, XhoI fragment between th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
weightaaaaaaaaaa
weightaaaaaaaaaa
weightaaaaaaaaaa
Login to View More

Abstract

A method for controlling endosperm size and development in plants. The method employs nucleic acid constructs encoding proteins involved in genomic imprinting, in the production of transgenic plants. The nucleic acid constructs can be used in the production of transgenic plants to affect interspecific hybridisation.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application is a divisional of Ser. No. 10 / 058,825, filed on Jan. 30, 2002, which is a continuation of International Application No. PCT / GB00 / 02953, internationally filed Jul. 31, 2000, which was published in English, and claims priority to Great Britain Application No. 9918061.4, filed Jul. 30, 1999, all of which are incorporated by reference in their entirety.BACKGROUND OF THE INVENTION [0002] 1. Field of the Invention [0003] The present invention relates to methods for controlling endosperm size and development, and seed viability in plants. The invention also relates to nucleic acid constructs for use in such methods, as well as modified plants per se. [0004] 2. Related Art [0005] Yield in crop plants where seed is the harvested product is usually defined as weight of seed harvested per unit area (Duvick, 1992). Consequently, individual seed weight is regarded as a major determinant of yield. Most monocotyledonous plants e.g. m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): A01H1/00C07H21/04C12N15/82C12N5/04
CPCC07K14/415C12N9/1007C12N15/8216C12N15/8261C12N15/8262C12N15/8287Y02A40/146
Inventor SCOTT, RODERICK
Owner UNIVERSITY OF BATH