Yarrowia lipolytica engineering bacterium for producing L-malic acid and application of Yarrowia lipolytica engineering bacterium

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to yarrowia lipolytica engineering bacteria for producing L-malic acid and application. Glycerin is used as a carbon source, and the metabolic flow of a glyoxylic acid circulation path in the yarrowia lipolytica peroxisome is enhanced to promote the synthesis of L-malic acid. In addition, malic acid transporter SpMAE1 from schizosaccharomyces pombe is further introduced, feedback inhibition is relieved, and product efflux is accelerated. Meanwhile, it is accidentally found that the acid resistance of the Po1g-CEE2 + Sp strain obtained after over-expression of endogenous genes ICLC (isocitrate lyase), MSE (malate synthase), MDHE2 (malate dehydrogenase) and heterologous transporter gene SpMAE1 on the basis of the original strain Po1g delta ku70 is improved to 2.76 from 3.58 compared with that of the original strain, and the enhancement of the acid resistance is beneficial to production of L-malic acid.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to an engineering bacterium of Yarrowia lipolytica for producing L-malic acid and an application thereof. Background Art

[0002] Yarrowia lipolytica is a safe and unconventional yeast with a large number of precursors such as acetyl-CoA in its cells, which can be used to synthesize various downstream substances. Because this yeast is a typical oil-producing microorganism, the synthesis and metabolic reactions of triacylglycerol (TAG) are active, and the β-oxidation of fatty acids in peroxisomes provides sufficient acetyl-CoA and reducing power NADPH for the glyoxylate cycle, and promotes the production of L-malic acid, an intermediate product of the glyoxylate cycle. Glycerol metabolism in Yarrowia lipolytica is conducive to the production of various valuable products as a non-toxic, cheap and renewable carbon source.

[0003] There are three metabolic pathways of L-malate in Yarrowia lipolytica, namely the TCA cycle pathway in mitochondria, the rTCA pathway in the cytoplasm, and the glyoxylate cycle pathway in peroxisomes and cytoplasms. With the support of substrate and chassis cell β-oxidation advantages, the synthesis of L-malate in the glyoxylate cycle in peroxisomes can be efficiently obtained under the joint action of isocitrate lyase, malate synthase, and malate dehydrogenase, such as Figure 1 shown.

[0004] L-Malic acid (C4H6O5), also known as L-hydroxysuccinic acid, is an important four-carbon dicarboxylic acid. Its melting point is about 47°C and its boiling point is about 135°C. L-Malic acid is a white crystalline powder with strong hygroscopicity. It is completely soluble in water and easily soluble in ethanol and chloroform. It has no mutagenic or teratogenic effects. As early as 1967, it was registered and confirmed by the U.S. Food and Drug Administration as a safe, non-toxic, harmless, edible organic acid, and its allowable intake (ADI) does not require special regulations. It is widely used in the food and beverage industry because of its comfortable acidity and soft taste. In addition, it is also used as an additive, antioxidant and disinfectant, providing non-food applications for medicine, cosmetics and daily chemicals.

[0005] There are two ways to produce L-malic acid in industry: chemical synthesis and biosynthesis. Chemical synthesis is mainly obtained by using petrochemical resources. This method has high requirements for equipment and causes environmental pollution, which limits its large-scale industrial production. The biosynthesis method of L-malic acid is to prepare the target product by genetically modifying the metabolic pathway of microorganisms. Among them, fungi such as aflatoxin, Aspergillus niger, Aspergillus oryzae, Saccharomyces cerevisiae, and Pichia pastoris have a strong ability to produce L-malic acid naturally. However, fungi have a mycelial phenotype, which causes high broth viscosity during fermentation, which poses a major challenge to the mixing and aeration process in conventional stirred tank fermenters. In addition, the fermentation broth is acidic during fermentation, and the low pH environment affects the performance of the strain. Yarrowia lipolytica has a natural high tolerance to acidic environments, a short fermentation cycle, simpler fermentation broth treatment, and a high recovery rate. There are no reports on the application of metabolic engineering to transform Yarrowia lipolytica to produce L-malic acid. Summary of the invention

[0006] The technical problem to be solved by the present invention is to explore for the first time the potential problem of synthesizing L-malic acid in Yarrowia lipolytica, to provide an engineered strain of Yarrowia lipolytica that enhances the metabolic flow of the glyoxylate cycle in the peroxisome and introduces a malate transporter (SpMAE1) gene, thereby increasing the production of L-malic acid.

[0007] One of the technical solutions provided by the present invention is a method for producing L-malic acid using Yarrowia lipolytica, wherein the method is achieved by overexpressing isocitrate lyase (ICLC), malate synthase (MSE), and malate dehydrogenase (MDHE2) in the peroxisome of the Yarrowia lipolytica host; Furthermore, the malate transporter (SpMAE1) was also overexpressed in the Yarrowia lipolytica host; Furthermore, the Yarrowia lipolytica host is Yarrowia lipolytica ( Yarrowia lipolytica ) Po1gΔku70; Furthermore, the isocitrate lyase ICLC is derived from Yarrowia lipolytica, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.1; Furthermore, the malate synthase MSE is derived from Yarrowia lipolytica, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.2; Furthermore, the malate dehydrogenase MDHE2 is derived from Yarrowia lipolytica, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.3; Furthermore, the malate transporter SpMAE1 is derived from Schizosaccharomyces pombe, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.4.

[0008] The second technical solution provided by the present invention is an engineered Yarrowia lipolytica strain that produces L-malic acid, wherein the engineered strain is obtained by overexpressing isocitrate lyase (ICLC), malate synthase (MSE), and malate dehydrogenase (MDHE2) in the peroxisome of a Yarrowia lipolytica host, and simultaneously overexpressing a malate transporter (SpMAE1) in the cytoplasm; Furthermore, the Yarrowia lipolytica host is Yarrowia lipolytica ( Yarrowia lipolytica ) Po1gΔku70; Furthermore, the nucleotide sequence of the gene encoding the isocitrate lyase ICLC is shown in SEQ ID NO.1; the nucleotide sequence of the gene encoding the malate synthase MSE is shown in SEQ ID NO.2; the nucleotide sequence of the gene encoding the malate dehydrogenase MDHE2 is shown in SEQ ID NO.3; the nucleotide sequence of the gene encoding the malate transporter SpMAE1 is shown in SEQ ID NO.4; Furthermore, the isocitrate lyase ICLC shown in SEQ ID NO.1, the malate synthase MSE shown in SEQ ID NO.2, and the malate dehydrogenase MDHE2 shown in SEQ ID NO.3 were overexpressed in the peroxisome of Yarrowia lipolytica Po1gΔku70, and the malate transporter SpMAE1 described in SEQ ID NO.4 was overexpressed in the cytoplasm to obtain an engineered Yarrowia lipolytica strain Po1g-CEE2+Sp that produces L-malic acid.

[0009] The third technical solution provided by the present invention is the application of the engineering strain described in the second technical solution, especially in the production of L-malic acid; Furthermore, the method for synthesizing L-malic acid using the above strain under aerobic conditions in YPG medium is as follows: The seed liquid of the engineered strain Po1g-CEE2+Sp of Yarrowia lipolytica was inoculated into YPD medium at a rate of 1-1.2%, and cultured at 30-32°C and 200-220 rpm for 15-18 h. Then, it was transferred to YPG medium at a rate of 1.5-2% (v / v) and fermented at 30-32°C and 200-220 rpm for 120 ± 5 h.

[0010] The YPG culture medium comprises the following components: 18-22 g / L peptone, 8-12 g / L yeast extract powder, 90-110 g / L glycerol, 0.15 g / L K2HPO4, 0.15 g / L KH2PO4, 40 g / L CaCO3, and the balance is water. The culture medium is sterilized at 115-121° C. for 20 min.

[0011] Furthermore, samples were taken after 120 h of fermentation to detect the content of L-malic acid. The L-malic acid content in the fermentation broth of the Po1g-CEE2+Sp strain reached 37.0 g / L under shake flask fermentation.

[0012] Beneficial effects: The present invention uses glycerol as a carbon source and enhances the metabolic flow of the glyoxylate cycle pathway in the peroxisome of Yarrowia lipolytica to promote the synthesis of L-malic acid. In addition, the present invention also introduces the malate transporter SpMAE1 from Schizosaccharomyces pombe to relieve feedback inhibition and accelerate product efflux. At the same time, it was unexpectedly found that the acid resistance of the Po1g-CEE2+Sp strain obtained after overexpressing the endogenous genes ICLC (isocitrate lyase), MSE (malate synthase), MDHE2 (malate dehydrogenase) and the heterologous transporter gene SpMAE1 on the basis of the original strain Po1g Δku70 was improved from 3.58 to 2.76 relative to the original strain, and the enhancement of acid resistance will be beneficial to the production of L-malic acid.

[0013] The results showed that the engineered strain Po1g-CEE2+Sp, which overexpressed pathway genes and introduced heterologous transporters, produced 37.0 g / L of L-malic acid under YPG fermentation conditions. It can be seen that the modified genetically engineered strain is more suitable for industrial applications, which can reduce production costs and improve production efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is the synthesis pathway of L-malate in the peroxisomal glyoxylate cycle; Figure 2 This is the recombinant plasmid map in strain Po1g-CEE2+Sp; Figure 3 Validation plots for recombinant strains Po1g-ICLC, Po1g-MSE, and Po1g-MDHE2 (2020 bp, 2040 bp, and 1393 bp); Figure 4 It is the validation map of the recombinant strain Po1g-ICLC+MSE+MDHE2 (2573 bp); Figure 5 is the verification map of the recombinant strain Po1g-CEE2+Sp (5053 bp); Figure 6 The yield diagram in Example 4 Specifically, the yield graphs of strains Po1gΔku70, Po1g-ICLC, Po1g-MSE, Po1g-MDHE2, Po1g-ICLC+MSE+MDHE2, and Po1g-CEE2+Sp in medium YPG; Figure 7 This is the growth curve of strain Po1gΔku70 at different pH; Figure 8 This is the growth curve of strain Po1g-CEE2+Sp at different pH; Fig. 9 These are the growth curves of strains Po1gΔku70, Po1g-ICLC, Po1g-MSE, Po1g-MDHE2, Po1g-ICLC+MSE+MDHE2, and Po1g-CEE2+Sp at pH 2.76. DETAILED DESCRIPTION

[0015] The technical content of the present invention is further described below in conjunction with the embodiments. It should be noted that, in the absence of conflict, the embodiments in the present invention are only a part of the embodiments in the present invention, rather than all the embodiments. Based on the embodiments of the present invention, other embodiments obtained by ordinary technicians in this field without making creative work are all within the protection scope of the present invention.

[0016] The Yarrowia lipolytica Po1gΔku70 (genotype MATA, xpr2-332, leu2-270, ku70-, ura3-302::URA3, Axp-2) used in the present invention is a prior art, which is a knockout in the Yarrowia lipolytica Po1g strain. KU70 The gene was obtained, and its construction method was referred to the literature Genetic engineering of an unconventional yeast for renewable biofuel and biochemical production. Journal of Visualized Experiments, 2016, 115, e54371. The Yarrowia lipolytica Po1g strain was purchased from Yeastarn Biotech Co. in Taiwan, China.

[0017] The pYLEX1 plasmid used in the present invention was purchased from Yeastern Biotech Co., Ltd. The plasmid carries an auxotrophic screening gene leucine expression cassette, a marker gene Amp, a strong promoter hp4d, and a terminator XPR2 term.

[0018] The culture medium involved in the present invention is as follows: YPD solid culture medium formula: yeast powder 10 g / L, peptone 20 g / L, glucose 20 g / L, agar powder 20 g / L, and the balance is water.

[0019] YNB solid screening medium formula: YNB (Yeast Nitrogen Base) 6.7 g / L, glucose 20 g / L, agar powder 20 g / L, and the balance is water.

[0020] The coding sequences of some genes used in the process of constructing the Yarrowia lipolytica engineered strain in the embodiment of the present invention are shown in SEQ ID NOs. 1-4.

[0021] The present invention is further explained below by means of specific examples.

[0022] Example 1 Construction of Yarrowia lipolytica engineered strains Po1g-ICLC, Po1g-MSE, Po1g-MDHE2 for enhancing the L-malic acid production pathway of the glyoxylate cycle metabolic flux in peroxisomes 1.1 Construction of expression vector According to the genome sequence of Yarrowia lipolytica in Genbank (shown in SEQ ID NO.1-3), the Yarrowia lipolytica genomic DNA was used as a template, and the isocitrate lyase (ICLC, YALI0C16885g, SEQ ID NO.1), citrate synthase (MSE, YALI0E15708g, SEQ ID NO.2), and malate dehydrogenase (MDHE2, YALI0E14190g, SEQ ID NO.3) gene fragments were obtained by primer PCR according to the sequence of the expression vector pYLEX1; the primers for PCR to obtain the ICLC, MSE, and MDHE2 gene fragments are as follows: iclC-F:ACAACCACACACATCCACGTGAATGTCCGAACAGCAGCGATT iclC-R: TTAGTTTCGGGTTCCCACTTAAAGCTTGGACTTGAACTGGTC msE-F:ACAACCACACACATCCACGTGATGACTACTGTTCCTTCTAGCAACAC msE-R: TTAGTTTCGGGTTCCCACTTAGAGCTTGGAAGAGCTGCCA mdhE2-F:ACTTTGGTCTACTCCGGTACAAATGGTTAAAGCTGTCGTTGCC mdhE2-R: GGGACAGGCCATGGAGTTAGATCTTGGCAGGAGGAGG The specific method is as follows: Using the genome from Yarrowia lipolytica Po1g Δku70 as a template, PCR amplification was performed using primers iclC-F / R, msE-F / R, and mdhE2-F / R to obtain a gene fragment carrying the pYLEX1 homologous sequence. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 2 min, 72℃ extension for 10 min after 30 cycles, and storage at 4℃.

[0023] Plasmid pYLEX1 was obtained by Pml Ⅰ or Kpn After digestion with endonuclease I, the fragment was recovered and purified.

[0024] The pYLEX1 linearized fragment was recombined with the ICLC, MSE, and MDHE2 gene fragments using the Vazyme assembly kit ClonExpress II One Step Cloning Kit to construct the pYLEX1-ICLC, pYLEX1-MSE, and pYLEX1-MDHE2 plasmids. 1.2 The engineered strain was constructed using the lithium acetate transformation method, and the steps were as follows: (1) Preparation of Yarrowia lipolytica Po1g Δku70 competent cells I. Pick a single colony of Yarrowia lipolytica from the streaked plate on YPD medium with an inoculation loop and inoculate it into 50 mL of liquid YPD medium. Cultivate at 28°C and 225 rpm in a shaking incubator until the OD 600 =15.

[0025] II. Centrifuge at 12000 rpm for 4 min at room temperature, collect the cells, rinse twice with 10 mL of sterile water, suspend the cells with 5 mL of 0.1 mol / L lithium acetate (pH 6.0), and incubate at room temperature for 10 min.

[0026] III. Add sterile cooled glycerol to the competent cells to a final concentration of 25% (v / v), aliquot 100 μL into sterile 2 mL centrifuge tubes for yeast transformation or store in a -80℃ refrigerator.

[0027] (2) Linearize the plasmids pYLEX1-ICLC, pYLEX1-MSE, and pYLEX1-MDHE2 and transform them into Po1gΔku70 competent cells, respectively, and screen the recombinants.

[0028] I. Gently mix 100 μL of competent cells, 500 ng-1 μg of linearized recombinant plasmid, and 10 μL of salmon sperm DNA (10 mg / mL) and incubate at 30°C for 15 min.

[0029] II. Add 700 μL of 40% PEG 4000, mix by pipetting, and incubate at 30°C, 225 rpm for 1 h.

[0030] III. Place the centrifuge tube in a 39℃ water bath and warm it for 1 hour.

[0031] IV. Add 1 mL of YPD medium, resume culture at 30°C and 225 rpm for 2 h, centrifuge at 12,000 rpm for 1 min at room temperature, discard the supernatant and resuspend the cells with 1 mL of sterile water.

[0032] V. Centrifuge at 12,000 rpm for 1 min at room temperature to collect the cells, resuspend them in 100 μL of sterile water and spread them on a solid plate containing the screening medium YNB, and culture them at 30°C for 2-3 days.

[0033] VI. Randomly select recombinants and perform PCR verification using primers PYL-F / R (PYL-F: CCTCGATCCGGCATGCACTGATCACG; PYL-R: TAGGCAACAGCGTTGGGAGAGCCCTTGAGG). The obtained fragment sizes are 2020 bp, 2040 bp, and 1393 bp. Figure 3 The band size was consistent with theoretical expectations, indicating that the target gene was successfully integrated into the Yarrowia lipolytica genome.

[0034] Sequencing further verifies whether the pYLEX1-ICLC, pYLEX1-MSE, and pYLEX1-MDHEE2 plasmid restriction fragments have been integrated into the genome. The following will be obtained: The engineered Yarrowia lipolytica strains overexpressing ICLC, MSE, and MDHE2 genes were named Po1g-ICLC, Po1g-MSE, and Po1g-MDHE2, respectively.

[0035] Example 2 Construction of the L-malic acid production pathway of Yarrowia lipolytica strains Po1g-ICLC+MSE+MDHE2 and Po1g-CEE2+Sp that enhance the metabolic flux of the glyoxylate cycle in peroxisomes 2.1 Construction of expression vector (1) Plasmid pYLEX1-ICLC FspA After digestion with endonuclease I, the cells were recovered and purified. FspA Primer design based on the sequence at I: Fsbox-F: GACAGGAGCACGATCATGCGCACTTATGCGACTCCTGCATTAGGA Fsbox-R: GCAGGAGTCGCATAAGTGCTGACAGCTTATCATCGATGATAAGC Using the expression vector pYLEX1-MSE as a template, the MSE expression cassette fragment carrying the corresponding terminal homologous sequence was amplified by PCR using Fsbox-F / R primers. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 2 min, 72℃ extension for 10 min after 30 cycles, and storage at 4℃. The pYLEX1-ICLC restriction fragment and the MSE expression cassette fragment were assembled using the Vazyme assembly kit ClonExpress II One Step Cloning Kit to construct the pYLEX1-ICLC+MSE plasmid, and the MSE expression cassette was reserved on the integration fragment by primer design. FspA I site was used as the gene integration site for the next round of plasmid construction.

[0036] Plasmid pYLEX1-ICLC+MSE FspA After digestion with endonuclease I, the cells were recovered and purified. FspA Primer design based on the sequence at I: 3-FSP-F: GACAGGAGCACGATCATGCGCACAGGAGCTGACTGGGTTGAAGG 3-FSP-R: GCAGGAGTCGCATAAGTGCTGACAGCTTATCATCGATGATAAGC The expression vector pYLEX1-MDHE2 was used as a template and 3-FSP-F / R primers were used to PCR amplify the MDHE2 expression cassette fragment carrying the corresponding terminal homologous sequence. The PCR reaction conditions were: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 2 min, 72℃ extension for 10 min after 30 cycles, and storage at 4℃. The pYLEX1-ICLC+MSE restriction fragment and the MDHE2 expression cassette fragment were assembled using the Vazyme assembly kit ClonExpress II One Step Cloning Kit to complete the construction of the pYLEX1-ICLC+MSE+MDHE2 plasmid.

[0037] (2) Plasmid pYLEX1-ICLC+MSE+MDHE2 was used Nr After digestion with endonuclease I, the gene was recovered and purified. The malate transporter gene from Schizosaccharomyces pombe (GenBank accession number: 2543334) was codon-optimized according to the codon usage preference of Yarrowia lipolytica and then gene synthesis was performed (SEQ ID NO.4). The gene plasmid pYLEX1-SpMAE1 synthesized by GeneWeiZ was used as a template to obtain the SpMAE1 gene expression cassette fragment by primer PCR; the primers for PCR to obtain the SpMAE1 gene expression cassette fragment are as follows: P4-F: CCATCCAGCCTCGCGTCGACTCCTGCATTAGGAAGCAGCC; P4-R: ACGTCTTGCTGGCGTTCGCGATAAGCTGTCAAACATGAGAATTCGG; Using the expression vector pYLEX1-SpMAE1 as a template, the SpMAE1 expression cassette fragment carrying the corresponding terminal homologous sequence was amplified by PCR using P4-F / R primers. PCR reaction conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 2 min, 72℃ extension for 10 min after 30 cycles, and storage at 4℃. The pYLEX1-ICLC+MSE+MDHE2 restriction fragment and the SpMAE1 expression cassette fragment were assembled using the Vazyme assembly kit ClonExpress II One Step Cloning Kit to construct the pYLEX1-CEE2+Sp plasmid (plasmid map as shown in Figure 2 as shown).

[0038] 2.2 The engineered strains Po1g-ICLC+MSE+MDHE2 and Po1g-CEE2+Sp were constructed using the lithium acetate transformation method. The steps are as follows: (1) Prepare competent cells of Yarrowia lipolytica Po1g Δku70.

[0039] (2) Linearize the plasmids pYLEX1-ICLC+MSE+MDHE2 and pYLEX1-CEE2+Sp and transform them into Po1gΔku70 competent cells, respectively, and screen the recombinants.

[0040] I. Gently mix 100 μL of competent cells, 500 ng-1 μg of linearized recombinant plasmid, and 10 μL of salmon sperm DNA (10 mg / mL) and incubate at 30°C for 15 min.

[0041] II. Add 700 μL of 40% PEG 4000, mix by pipetting, and incubate at 30°C, 225 rpm for 1 h.

[0042] III. Place the centrifuge tube in a 39℃ water bath and warm it for 1 hour.

[0043] IV. Add 1 mL of YPD medium, resume culture at 30°C and 225 rpm for 2 h, centrifuge at 12,000 rpm for 1 min at room temperature, discard the supernatant and resuspend the cells with 1 mL of sterile water.

[0044] V. Centrifuge at 12,000 rpm for 1 min at room temperature to collect the cells, resuspend them in 100 μL of sterile water and spread them on a solid plate containing the screening medium YNB, and culture them at 30°C for 2-3 days.

[0045] VI. Randomly select recombinants and perform PCR verification using the following primers (Po1g-ICLC+MSE+MDHE2 verification results are as follows Figure 4 、Po1g-CEE2+Sp verification results are as follows Figure 5 ), the band size is consistent with theoretical expectations, indicating that the target gene has been successfully integrated into the Yarrowia lipolytica genome. Among them, the verification primers of Po1g-ICLC+MSE+MDHE2 are 3-E1E2-F and 3-ER, and the verification band is 2573 bp; the verification primers of Po1g-CEE2+Sp are EC-F and DC-R, and the verification band is 5053 bp: 3-E1E2-F: AGGCTGGTTTCCGATTTGC; 3-ER:CGGCCACAGTTGAGACCAG; EC-F: CACCACTCTCCTTTACGACCA; DC-R: GTGGTTCTTCTCGTGCTCCTG.

[0046] Sequencing further verified whether the pYLEX1-ICLC+MSE+MDHE2 and pYLEX1-CEE2+Sp plasmid enzyme fragments were integrated into the genome. The obtained Yarrowia lipolytica engineered bacteria with overexpression of ICLC, MSE, and MDHE2 genes were named Po1g-ICLC+MSE+MDHE2; the Yarrowia lipolytica engineered bacteria with overexpression of CLC, MSE, MDHE2, and SpMAE1 genes were named Po1g-CEE2+Sp.

[0047] (3) The method used for the above PCR amplification is as follows: ①The PCR reaction system is as shown in Table 1-1.

[0048] Table 1-1 PCR reaction system

[0049] ②PCR reaction conditions are shown in Table 1-2.

[0050] Table 1-2 PCR reaction conditions

[0051] Note: Set the denaturation, annealing and extension parts for 34 cycles and verify by 1% agarose gel electrophoresis.

[0052] Example 3 Comparison of the efficiency of producing L-malic acid in YPG medium by strains Po1gΔku70, Po1g-ICLC, Po1g-MSE, Po1g-MDHE2, Po1g-ICLC+MSE+MDHE2, and Po1g-CEE2+Sp Experimental strains: engineered Yarrowia lipolytica strains Po1g-ICLC, Po1g-MSE, Po1g-MDHE2, Po1g-ICLC+MSE+MDHE2, Po1g-CEE2+Sp.

[0053] Yarrowia lipolytica Po1g-ICLC, Po1g-MSE, Po1g-MDHE2, Po1g-ICLC+MSE+MDHE2, and Po1g-CEE2+Sp stored in frozen glycerol tubes were streaked onto YPD solid plates and cultured at 30°C for 30 h.

[0054] The Po1g-ICLC, Po1g-MSE, Po1g-MDHE2, Po1g-ICLC+MSE+MDHE2, and Po1g-CEE2+Sp colonies grown on YPD solid plates were respectively inoculated into test tubes containing 5 mL of YPD liquid culture medium (20 g / L peptone, 10 g / L yeast powder, 20 g / L glucose) and activated at 30°C and 220 rpm for 15 h.

[0055] The seed liquid of the activated Yarrowia lipolytica engineered strains Po1g-ICLC, Po1g-MSE, Po1g-MDHE2, Po1g-ICLC+MSE+MDHE2, and Po1g-CEE2+Sp was inoculated into 25 mL YPD medium at a 1% inoculation rate, and cultured at 30°C and 220 rpm for 15 h. Then 1 mL of the bacterial liquid was transferred to 50 mL and YPG medium and fermented at 30°C and 220 rpm for 120 h.

[0056] The YPG medium comprises the following components: 20 g / L peptone, 10 g / L yeast extract powder, 100 g / L glycerol, 0.15 g / L K2HPO4, 0.15 g / L KH2PO4, 40 g / L CaCO3, and the balance is water. The medium is sterilized at 121°C for 20 min.

[0057] Method for determining the content of L-malic acid: After 120 h of fermentation, fully mix the fermentation broth, quickly take 2 ml into a 10 ml centrifuge tube, slowly add an equal volume of 2M HCL solution to dissolve the organic acid calcium in the fermentation broth, react for 10 minutes, then centrifuge at 12000 rpm for 10 minutes to take the supernatant, dilute the corresponding multiple, and dilute with ultrapure water. Use a disposable syringe to filter a 0.22 μm water membrane, and the filtered sample is placed in a brown liquid phase vial, labeled with information, and wait for machine testing. The content of L-malic acid in the fermentation broth is determined by high performance liquid chromatography (HPLC), and the standard curve is prepared by standard products.

[0058] Wherein, the above-mentioned high performance liquid chromatography detection conditions are: A high performance liquid chromatograph equipped with a UVD 170U ultraviolet detector from Agilent Technologies was selected, and the ion exchange column was Aminex HPX-87H (7.8 mm×300 mm). 5 mM H2SO4 was used as the mobile phase, the flow rate was 0.6 mL / min, the column temperature was 60°C, the detection wavelength was 215 nm, and the injection volume was 10 ul.

[0059] The results are as follows Figure 6 As shown, after 120 h of fermentation, the L-malic acid contents in YPG fermentation broth of Po1g Δku70, Po1g-ICLC, Po1g-MSE, Po1g-MDHE2, Po1g-ICLC+MSE+MDHE2, and Po1g-CEE2+Sp strains reached 20.6 g / L, 25.7 g / L, 26.5 g / L, 27.2 g / L, 30.5 g / L, and 37.0 g / L, respectively.

[0060] Example 4 Growth of the original strain Po1g Δku70 and the engineered strain Po1g-CEE2+Sp under different pH conditions Experimental strains: original strain Po1g Δku70 of Yarrowia lipolytica and engineered strain Po1g-CEE2+Sp.

[0061] Yarrowia lipolytica Po1g Δku70 and Po1g-CEE2+Sp stored in frozen glycerol tubes were streaked onto YPD solid plates and cultured at 30°C for 30 h.

[0062] The Po1gΔku70 and Po1g-CEE2+Sp colonies grown on the YPD solid plates were respectively inoculated into test tubes containing 5 mL of YPD liquid culture medium (20 g / L peptone, 10 g / L yeast powder, 20 g / L glucose) and activated by shaking culture at 30°C and 220 rpm for 15 h.

[0063] The seed liquid of the activated Yarrowia lipolytica strains Po1g Δku70 and Po1g-CEE2+Sp was inoculated into 50 mL YPD medium at 1% inoculation, and cultured at 30°C and 220 rpm for 15 h. Then 1 mL of the engineered strains Po1gΔku70 and Po1g-CEE2+Sp were transferred to 50 mL YPG medium, and the pH value of the medium was adjusted by adding malic acid. The added concentrations of malic acid were 0 g / L, 10 g / L, 20 g / L, 30 g / L, 40 g / L, 80 g / L, and 100 g / L, and the corresponding medium pH was 6.85, 3.58, 3.11, 2.95, 2.76, 2.43, and 2.33, respectively.

[0064] The results are as follows Figure 7 , Figure 8 As shown in Figure 2, Po1g Δku70 showed normal growth at pH 6.85 and 3.58 during the 48h logarithmic growth phase. At pH 3.11, OD 600 The growth of the engineered strain Po1g-CEE2+Sp was significantly inhibited under the condition of pH 2.76, while it remained in the normal growth range under the condition of pH 6.85, 3.58, 3.11, and 2.95. It can be seen that the engineered strain Po1g-CEE2+Sp obtained after genetic modification increased the acid resistance from pH 3.58 of the original strain Po1g Δku70 to pH 2.76.

[0065] Example 5 Growth of engineered strains Po1g-ICLC, Po1g-MSE, Po1g-MDHE2, Po1g-ICLC+MSE+MDHE2, Po1g-CEE2+Sp at pH 2.76 Experimental strains: Yarrowia lipolytica Po1gΔku70, Yarrowia lipolytica engineered strain Po1g-ICLC, Po1g-MSE, Po1g-MDHE2, Po1g-ICLC+MSE+MDHE2, Po1g-CEE2+Sp.

[0066] Yarrowia lipolytica Po1gΔku70, Po1g-ICLC, Po1g-MSE, Po1g-MDHE2, Po1g-ICLC+MSE+MDHE2, and Po1g-CEE2+Sp stored in frozen glycerol tubes were streaked onto YPD solid plates and cultured at 30°C for 30 h.

[0067] The Po1gΔku70, Po1g-ICLC, Po1g-MSE, Po1g-MDHE2, Po1g-ICLC+MSE+MDHE2, and Po1g-CEE2+Sp colonies grown on YPD solid plates were respectively inoculated into test tubes containing 5 mL of YPD liquid culture medium (20 g / L peptone, 10 g / L yeast powder, 20 g / L glucose) and activated at 30°C and 220 rpm for 15 h.

[0068] The seed liquid of the activated Yarrowia lipolytica strains Po1gΔku70, Po1g-ICLC, Po1g-MSE, Po1g-MDHE2, Po1g-ICLC+MSE+MDHE2, and Po1g-CEE2+Sp was inoculated into 50 mL of YPD medium at a 1% inoculation rate, and cultured at 30°C, 220 rpm for 15 h. Then 1 mL of the bacterial liquid of the engineered strains Po1gΔku70, Po1g-ICLC, Po1g-MSE, Po1g-MDHE2, Po1g-ICLC+MSE+MDHE2, and Po1g-CEE2+Sp was transferred to 50 mL of YPG medium, and the pH value of the medium was adjusted by adding malic acid.

[0069] When 40 g / L malic acid was added exogenously, the pH of the culture medium was 2.76, and the culture was fermented at 30°C and 220 rpm for 72 h. The OD of each strain was measured every 12 h. 600 The absorbance values ​​at 37° were calculated, and the growth curves of strains Po1gΔku70, Po1g-ICLC, Po1g-MSE, Po1g-MDHE2, Po1g-ICLC+MSE+MDHE2, and Po1g-CEE2+Sp were plotted.

[0070] The results are as follows Fig. 9 As shown, under the condition of pH 2.76, the original strain Po1g Δku70 showed growth inhibition, while the engineered strain Po1g-CEE2+Sp grew well. The engineered strains Po1g-ICLC, Po1g-MSE, Po1g-MDHE2, and Po1g-ICLC+MSE+MDHE2 showed different degrees of growth, but the engineered strain Po1g-CEE2+Sp had a clear growth advantage.

[0071] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the patent. It should be pointed out that, for ordinary technicians in this field, the above-mentioned implementation methods can also be modified, combined and improved without departing from the concept of this patent, which all belong to the protection scope of this patent. Therefore, the protection scope of this patent shall be based on the claims.

Claims

1. A method for producing L-malic acid using Yarrowia lipolytica, characterized in that: The method is achieved by overexpressing isocitrate lyase ICLC, malate synthase MSE and malate dehydrogenase MDHE2 in the peroxisome of a Yarrowia lipolytica host.

2. The method for producing L-malic acid using Yarrowia lipolytica according to claim 1, characterized in that: The malate transporter SpMAE1 was also overexpressed in the Yarrowia lipolytica host.

3. An engineered strain of Yarrowia lipolytica for producing L-malic acid, characterized in that: The engineered bacteria is obtained by overexpressing isocitrate lyase ICLC, malate synthase MSE and malate dehydrogenase MDHE2 in the peroxisome of a Yarrowia lipolytica host, and simultaneously overexpressing malate transporter SpMAE1 in the cytoplasm.

4. The engineered Yarrowia lipolytica strain for producing L-malic acid according to claim 3, characterized in that: The Yarrowia lipolytica host is Yarrowia lipolytica ( Yarrowia lipolytica )Po1gΔku70.

5. The engineered Yarrowia lipolytica strain for producing L-malic acid according to claim 3, characterized in that: The nucleotide sequence of the gene encoding the isocitrate lyase ICLC is shown in SEQ ID NO.1; the nucleotide sequence of the gene encoding the malate synthase MSE is shown in SEQ ID NO.2; the nucleotide sequence of the gene encoding the malate dehydrogenase MDHE2 is shown in SEQ ID NO.3; the nucleotide sequence of the gene encoding the malate transporter SpMAE1 is shown in SEQ ID NO.

4.

6. The engineered Yarrowia lipolytica strain for producing L-malic acid according to claim 3, characterized in that: The isocitrate lyase ICLC shown in SEQ ID NO.1, the malate synthase MSE shown in SEQ ID NO.2, and the malate dehydrogenase MDHE2 shown in SEQ ID NO.3 were overexpressed in the peroxisome of Yarrowia lipolytica Po1gΔku70, and the malate transporter SpMAE1 shown in SEQ ID NO.4 was overexpressed in the cytoplasm to obtain an engineered Yarrowia lipolytica strain Po1g-CEE2+Sp that produces L-malic acid.

7. Use of the engineered Yarrowia lipolytica according to any one of claims 3 to 6 in producing L-malic acid.

Images