Corynebacterium glutamicum producing strain for efficiently producing D-pantothenic acid as well as construction method and application of corynebacterium glutamicum producing strain

Abstract

The invention relates to the technical field of microbial metabolism engineering, in particular to a corynebacterium glutamicum producing strain for efficiently producing D-pantothenic acid as well as a construction method and application of the corynebacterium glutamicum producing strain. The construction method specifically comprises the following steps: (1) by taking wild corynebacterium glutamicum ATCC 13032 as a chassis, weakening ilvA, and constructing DPA1 through mutation expression; (2) knocking out the quinone pyruvate oxidoreductase and inserting a panBCE gene expression cassette into the quinone pyruvate oxidoreductase to construct DPA2; (3) introducing and using a pEC-xk99E overexpression plasmid to screen and express Escherichia coli W3110, Bacillus subtilis 168, and endogenous acetohydroxy acid synthase, acetolactate isomerized reductoisomerase and 2-hydroxy acid dehydratase, and carrying out a step (2) of carrying out a step (3) of screening and expressing the Escherichia coli W3110, Bacillus subtilis 168, and endogenous acetohydroxy acid synthase, acetolactate isomerized reductoisomerase and 2-hydroxy acid dehydratase in the DPA2; and (4) under the control of a strong promoter, carrying out tandem overexpression on the screened ilvBNCD gene by using pEC-xk99E, constructing DPA3, and enhancing a pantothenic acid main synthesis pathway and an upstream pathway pulling force, thereby obtaining the corynebacterium glutamicum for efficiently producing D-pantothenic acid. The strain provided by the invention can produce D-pantothenic acid with high yield and high conversion rate by utilizing a carbon source, and has important industrial application value.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial metabolic engineering, and in particular to a Corynebacterium glutamicum production bacterium capable of efficiently producing D-pantothenic acid, a construction method and an application thereof. Background Art

[0002] Pantothenic acid (D-Pantothenic Acid), chemical name α,γ-dihydroxy-β, also known as pantothenic acid, vitamin B5, molecular weight 219.24. D-pantothenic acid, as the precursor of coenzyme A (CoA) and acyl carrier protein (ACP) in the body, indirectly participates in the metabolism of sugar, protein and fat in the body. Therefore, D-pantothenic acid is widely used as an additive in the pharmaceutical, food and feed industries.

[0003] At present, there are three production methods: 1. Chemical production method: In 1940, Ringrose et al. synthesized D-pantothenate calcium for the first time by chemical synthesis. This method first chemically synthesizes the precursors of D-pantothenic acid, D / L-pantolactone and β-alanine, of which D / L-pantolactone is mainly synthesized by the sriller method. β-Alanine is mainly prepared by chemical methods using intermediates such as acrylonitrile, β-aminopropionitrile and succinimide. Next, it can be divided into two routes to synthesize D-pantothenate calcium. One is the chiral resolution of D / L-pantolactone to obtain D-pantothenate calcium by direct reaction with β-aminopropionic acid calcium to obtain D-pantothenate calcium; the other is that D / L-pantolactone directly reacts with β-aminopropionic acid calcium to generate chromatic pantothenate calcium, and then D-pantothenate calcium is obtained by crystallization induced resolution. 2. Enzymatic production method: Enzymatic production has the advantages of mild reaction conditions and less environmental pollution. At present, the technical route of selectively hydrolyzing D-pantoic acid lactone with microbial enzymes to split D / L-pantoic acid lactone has been industrially implemented. It mainly uses D-pantoic acid lactone hydrolase to hydrolyze D / L-pantoic acid lactone into D-pantoic acid lactone, and then uses D-pantoic acid lactone hydrolase to hydrolyze D-pantoic acid lactone into D-pantothenic acid, and then separates D-pantothenic acid and reacts with calcium β-alanine to obtain D-pantothenic acid. 3. Microbial fermentation method: Microbial fermentation method is a method of synthesizing the target product we need from cheap raw materials by using the natural multi-enzyme system or metabolic modification synthesis pathway in microorganisms. These studies have achieved remarkable results, but for industrial production, the production capacity of engineering strains still needs to be improved, and suitable strains need to increase production and yield. Therefore, improving the production performance of D-pantothenic acid engineering bacteria is the goal of those skilled in the art.

[0004] At present, the annual output of D-pantothenic acid calcium in the world is about 75 tons, and the annual demand is 100 tons. The product is in short supply. The main domestic manufacturers of D-pantothenic acid include Zhejiang Hangzhou Xinfu Pharmaceutical and Shandong Huachen, and foreign manufacturers include Germany's BASF and the Netherlands' DSM. As of 2019, the annual output of D-pantothenic acid in China reached about 24,000 tons, with an output value of about US$1.08 billion, a year-on-year increase of 27%. It can be seen that the D-pantothenic acid market has a high market demand and development potential. Summary of the invention

[0005] The purpose of the present invention is to overcome the problems of low yield and low conversion rate of D-pantothenic acid producing strains in the prior art in the fermentation production of D-pantothenic acid, and to provide a Corynebacterium glutamicum producing strain for efficiently producing D-pantothenic acid, a construction method and an application.

[0006] In order to achieve the above object, the present invention is implemented by the following technical solutions: In a first aspect, the present invention provides a Corynebacterium glutamicum production bacterium for efficiently producing D-pantothenic acid, a construction method and an application thereof, which specifically comprises the following steps: (1) Using wild-type Corynebacterium glutamicum ATCC 13032 as the chassis, ilvA was weakened and mutant expression was constructed to construct DPA1; (2) Knock out pyruvate quinone oxidoreductase (pqo) and insert a panBCE gene expression cassette to construct DPA2; (3) The pEC-xk99E overexpression plasmid was introduced into DPA2 to screen for the expression of Escherichia coli W3110, Bacillus subtilis 168, and endogenous acetohydroxyacid synthase (AHAS, ilvBN), acetolactate isomeroreductisomerase (AHAIR, ilvC), and 2-hydroxyacid dehydratase (DHAD, ilvD); (4) The selected ilvBNCD gene was overexpressed in tandem by pEC-xk99E under the control of a strong promoter to construct DPA3, thereby strengthening the main pantothenic acid synthesis pathway and the pulling force of the upstream pathway, thereby obtaining the Corynebacterium glutamicum that efficiently produces D-pantothenic acid.

[0007] The present invention uses wild-type Corynebacterium glutamicum ATCC 13032 as a chassis, weakens ilvA, and performs mutation to construct DPA1. In order to improve the production performance of D-pantothenic acid engineering bacteria, the main synthesis pathway carbon flow can be pulled to the product. The present invention knocks out pyruvate quinone oxidoreductase (pqo), enriches the pyruvate pool, reduces the loss of carbon metabolic flow, and inserts a panBCE gene expression frame to make the carbon metabolic flow flow more to the D-pantothenic acid synthesis direction. In order to better strengthen the carbon metabolic flux, Escherichia coli W3110, Bacillus subtilis 168, and endogenous acetohydroxy acid synthase, acetolactate isomeroreductase and 2-hydroxy acid dehydratase are overexpressed and screened in DPA2, and the screened ilvBNCD gene is expressed in series to strengthen the downstream pulling force of the main synthesis pathway of pantothenic acid. Through the series expression of the above effective transformation sites, the present invention successfully obtains a Corynebacterium glutamicum strain that efficiently produces D-pantothenic acid.

[0008] Encoding acetohydroxy acid synthase, acetolactate isomeroreductosomerase and 2-hydroxy acid dehydratase, the genes are usually represented as ilvBN, ilvC, ilvD. The gene sequences can be obtained from the public database National Center for Biotechnology Information (NCBI). For example, GenBank ID 3345149 of ilvBN, GenBank ID NC_000964.3 of ilvC, and GenBank ID NC_000913.3 of ilvD.

[0009] Preferably, the start codon of ilvA in the wild-type Corynebacterium glutamicum ATCC 13032 is changed from ATG to GTG.

[0010] Preferably, the panB, panC and panE are all integrated into the pqo gene locus.

[0011] Preferably, the panB and panC integrated into the pqo gene site are derived from Corynebacterium glutamicum ATCC13032, and panE is derived from Escherichia coli W3110; the ilvBN is derived from Corynebacterium glutamicum ATCC13032, the ilvC is derived from Bacillus subtilis 168, and the ilvD is derived from Escherichia coli W3110.

[0012] Preferably, the panB, panC, panE, ilvBN, ilvC and ilvD genes are expressed by a strong promoter.

[0013] Preferably, the strong promoter is Ptuf, and its nucleotide sequence is SEQ ID NO.1.

[0014] In a second aspect, a Corynebacterium glutamicum that efficiently produces D-pantothenic acid is prepared by any one of the above methods.

[0015] In a third aspect, the present invention further provides a use of D-pantothenic acid-producing Corynebacterium glutamicum in the fermentation production of D-pantothenic acid.

[0016] Preferably, the fermentation production process adopts electrotransformation.

[0017] Preferably, the application is to inoculate the Corynebacterium glutamicum into a fermentation medium, perform fermentation culture under suitable conditions, and separate and purify the culture fluid to obtain D-pantothenic acid.

[0018] The present invention inoculates the Corynebacterium glutamicum into a fermentation medium at a 2% inoculation rate, and ferments and cultures at 30°C and 180-220rpm, and separates and purifies the culture solution to obtain D-pantothenic acid. The final concentration of the fermentation medium (g) is as follows: 30% glucose, 25% corn steep liquor, 15% ammonium sulfate, 15% ammonium acetate, 2% urea, 2% sodium citrate, 1.3% K2HPO4·3H2O, 0.5% MgSO4·H2O, 0.06% L-isoleucine, 0.01% MnSO4·H2O, and 1x10 -4 , Thiamine 2x10 -4 , CaCO330, pH7.0-7.2. Sterilize at 115℃ for 10 min.

[0019] Before the fermentation culture of the present invention, slant activation and seed culture are first performed, and the seed liquid is inoculated into the fermentation medium. The slant activation method is: inoculate Corynebacterium glutamicum on an LB plate, culture overnight at 30°C to obtain slant bacteria; the seed culture method is: pick a single colony of slant bacteria and inoculate it into LB liquid culture medium, culture overnight at 30°C and 180-200rpm to obtain seed liquid. The seed liquid is inoculated into the fermentation medium at an inoculum amount of 2% by volume concentration.

[0020] The present invention has the following beneficial effects: (1) Compared with the wild-type and chassis strains, the modified Corynebacterium glutamicum provided by the present invention can better utilize carbon sources such as glucose to produce D-pantothenic acid, and the strains carrying the plasmid have good production performance, high yield and high conversion rate.

[0021] (2) The strain with the best performance obtained after modification in the present invention has a significantly improved level of D-pantothenic acid fermentation production compared to the starting strain DPA2, and the strain shake flask level is increased from 0.01 g / L to 2.35 g / L.

[0022] (3) The Corynebacterium glutamicum provided by the present invention has important industrial application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of metabolic modification of DPA-producing strains.

[0024] Figure 2 Schematic diagram of shake flask fermentation performance of WT, DPA1, DPA2 and DPA3 strains.

[0025] Figure 3 Fermentation test of DPA3 in a 5 L fermenter. DETAILED DESCRIPTION

[0026] The present invention is further described below in conjunction with specific embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are generally only embodiments of a part of the present invention, rather than all embodiments. Therefore, based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of the present invention.

[0027] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0028] Unless otherwise specified, the test materials used in the following examples are all conventional biochemical reagents.

[0029] The term "enhancement" refers to increasing the activity of an enzyme encoded by a corresponding polynucleotide. This can be done by increasing the number of copies of a gene or replacing the expression regulatory sequence of the gene on the genome (promoter replacement, etc.). The term "weakening" refers to weakening the activity of an enzyme encoded by a corresponding polynucleotide. This can be done by replacing the expression regulatory sequence of the gene on the genome (non-coding region sequence replacement, etc.).

[0030] LB liquid medium composition: peptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, solvent is deionized water, pH value is natural. LB plate is LB liquid medium with agar added to the final concentration of 2 g / L.

[0031] BHIS+Gly medium: brain-heart infusion medium 71g / L, D-sorbitol 37g / L, Gly40g / L, solvent is tap water, pH value is natural.

[0032] LBS solid medium: 10g / L peptone, 5g / L yeast extract, 10g / L NaCl, 100g / L sucrose, 4g / L agar, the solvent is tap water, and the pH value is natural.

[0033] Example 1 Weakening ilvA Using wild-type Corynebacterium glutamicum ATCC 13032 as the starting strain, the ilvA gene was weakened using the CRISPR / Cpf1 gene editing technology mediated by the editing plasmid pJYS3, and its start codon was changed from ATG to GTG to construct DPA1. The GenBank ID of the ilvA is Cgl2332.

[0034] Using Corynebacterium glutamicum ATCC 13032 as a template, primers 1 and 2 were used to obtain 1000bp of the upstream homology arm of ilvA by PCR, and primers 3 and 4 were used to obtain 1000bp of the GTG downstream homology arm of ilvA by PCR. The PCR reaction conditions were as follows: 98°C for 8 min; 98°C for 30 s, 56°C for 30 s, 72°C for 45 s, and 32 cycles. The obtained PCR stock solution was confirmed by nucleic acid gel electrophoresis, and the correct band fragment was purified according to the Qingke gel recovery kit, and the concentration was determined by Nano, and then placed at -20°C for use.

[0035] After streaking E. coli with pJYS3 empty plasmid on LB solid medium with kanamycin resistance for 12-16 hours, pick a single colony and culture it on LB liquid medium with kanamycin resistance at 37°C for 12-16 hours, collect 2-4 mL of fresh bacterial liquid, and extract the plasmid according to the instructions of the Qingke plasmid extraction kit. Determine the concentration of the extracted plasmid in NANO and store it at -20°C for later use.

[0036] The diluted pJYS3 vector was used as a template, and the linearized pJYS3 vector was obtained by PCR using primers 5 and 6. The PCR reaction conditions were as follows: 95 °C for 5 min; 95 °C for 30 s, 56 °C for 30 s, 72 °C for 5 min 15 s, and 32 cycles. After verification by nucleic acid electrophoresis, Dpn I was added at 37 °C for 30 min to eliminate the template. After the backbone concentration was determined using NANO, it was stored at -20 °C for later use.

[0037] The obtained ilvA upstream and downstream homology arms and the linearized pJYS3 vector were subjected to multi-fragment enzyme ligation using C115. The reaction system and conditions were as follows: Components Dosage μL C115 enzyme 5 A upstream homology arm 1 A downstream homology arm 1 Linearized pJYS3 vector 1 After reacting at 50°C for 30 min, the ligation product was obtained. The ligation product was transformed into E. coli DH5α competent cell and cultured at 37°C overnight. After successful colony PCR verification, the recombinant plasmid pJYS3-ilvA was obtained by picking bacteria and inoculating the test tube using a plasmid extraction kit. 10 μL of the plasmid was sent for sequencing and the remaining plasmid was stored at -20°C.

[0038] The plasmid with correct sequencing was introduced into the PAM site by PCR using primers 7 and 8. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 56 ℃ 30 s, 72 ℃ 6 min, and 32 cycles. The obtained PCR stock solution was confirmed by nucleic acid gel electrophoresis, and the correct band fragment was purified according to the Qingke gel recovery kit and the concentration was determined by Nano, and then directly transferred into E. coli DH5α for transformation, cultured overnight at 37 ℃, and successfully verified by colony PCR using primers 9 and 10. After picking the test tube, the recombinant plasmid pJYS3-ilvA (GTG) was extracted using a plasmid extraction kit, and 10 μL of the plasmid was sent for sequencing and the remaining plasmid was stored at -20 ℃.

[0039] Preparation of electroporation competent cells of wild-type Corynebacterium glutamicum: Pick a single colony of wild-type Corynebacterium glutamicum and inoculate it into a small shake flask containing 10 mL LB medium and culture it overnight in a constant temperature shaker at 30°C and 200 rpm. Pipette 1 mL of the overnight culture solution and transfer it to a 250 mL conical flask containing 40 mL LB medium and culture it in a constant temperature shaker at 30°C and 200 rpm for 6 hours until the OD value of the culture solution reaches 1. 600 Greater than 0.8. Place the cultured bacterial solution on ice to cool for about 20 minutes, pour into a 50 mL centrifuge tube, centrifuge at 4°C, 5000 rpm for 10 minutes, remove the supernatant in a clean bench to retain the bacteria, add about 20 mL of pre-sterilized pre-cooled 10% glycerol solution, resuspend in an ice-water bath, centrifuge at 4°C, 5000 rpm for 5 minutes, repeat three times, add 1 mL of pre-cooled 10% glycerol, resuspend in an ice-water bath, and dispense into 1.5 mL sterile centrifuge tubes (100 μL per tube), keep one tube for later use, and store the rest at -80°C.

[0040] Plasmid pJYS3-ilvA(GTG) was introduced into DPA1: 5 μL pJYS3-ilvA(GTG) was added to the electroporated competent DPA1 and gently pipetted to mix, ice bathed for 5 min, electroshocked twice at 1.8 kV, and then 1 mL preheated 46 ℃ LB medium was added. Immediately heat-shocked at 46 ℃ for 6 min, then cultured at 30 ℃ 200 rpm for two hours, coated with kan resistance LB plate, and cultured at 30 ℃ for 40 h. ilvA was verified by colony PCR with primers 11 and 12, and the strain with the correct band was selected for PCR product sequencing. The strain with the correct sequencing was named DPA1.

[0041] Deplasmidation: Pick the correctly sequenced colony to inoculate 10 mL of liquid antibiotic-free LB medium and culture it for 18 hours. Then dip the bacterial liquid and streak it on antibiotic-free medium. Culture it in an incubator at 30°C for 36-48 hours. Pick a single colony to copy the kan-resistant and antibiotic-free LB solid culture media. Select the strain that grows on the antibiotic-free plate and does not grow on the kan-resistant plate, indicating that the deplasmidation is successful. Keep the bacteria for later use.

[0042] Fermentation of strain DPA1: The wild type was used as the control strain, and it and DPA2 were inoculated into 10 mL of LB medium and cultured at 30 °C and 200 rpm as seed liquid; after 12 h, 1 mL of seed liquid was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium, and then cultured at 30 °C and 180 rpm until the fermentation liquid was reached. When the bacterial concentration reached OD 600 =0.8-1.0, add IPTG with a final concentration of 0.1 mM and continue to culture for 48 h; after the fermentation, take 1 mL of the fermentation liquid and centrifuge at 12000 rpm for 2 min at room temperature, take the supernatant and perform HPLC detection, and take another 1 mL of the fermentation liquid to measure the biomass OD 600 .

[0043] HPLC detection: (1) Chromatographic conditions: C18 column (250×4.6 mm, particle size 5μm, Agilent Technologies Co, Santa Clara, CA, USA); detection wavelength: 200 nm; column temperature: 30°C; (2) Sample treatment: dilute the sample with ultrapure water to keep the D-pantothenic acid content at 0.05-0.40 g / L; (3) Mobile phase: acetonitrile / water / phosphoric acid (volume ratio 50 / 949 / 1); (4) Data acquisition time: 15 min. This method was used for the detection of D-pantothenic acid in the following examples.

[0044] Example 2 Knockout of pyruvate quinone oxidoreductase (pqo) and integration of its site panBCE Using DPA1 as the starting strain, the pqo gene was knocked out using shuttle plasmid pk18mobsacB-mediated homologous recombination gene editing technology, and a panBCE expression frame was knocked in. The GenBank ID of panB is WP_011013400.1, the GenBank ID of panC is WP_011013399.1, and the GenBank ID of panE is NP_389394.1.

[0045] Using Corynebacterium glutamicum ATCC 13032 as template, primers 13 and 14 were used to obtain the upstream homology arm of pqo 500bp by PCR, and primers 15 and 16 were used to obtain the downstream homology arm of pqo 500bp by PCR. The PCR reaction conditions were as follows: 98 ℃ 8 min; 98 ℃ 30 s, 56 ℃ 30 s, 72 ℃ 45 s, and 32 cycles. Primers 17 and 18 were used to obtain the gene fragment of panBC 2000bp by PCR. The PCR reaction conditions were as follows: 98 ℃ 8 min; 98 ℃ 30 s, 56 ℃ 30 s, 72 ℃ 1 min 30 s, and 32 cycles. Using Escherichia coli W3110 as template, primers 19 and 20 were used to obtain a 1000bp gene fragment of panE by PCR. The PCR reaction conditions were as follows: 98°C for 5 min; 98°C for 30s, 56°C for 30s, 72°C for 45s, and 32 cycles. The obtained PCR stock solution was confirmed by nucleic acid gel electrophoresis, and the correct band fragment was purified according to the Qingke gel recovery kit, and the concentration was determined by Nano, and then placed at -20°C for use.

[0046] After streaking E. coli with pk18mobsacB empty plasmid on LB solid medium with kanamycin resistance for 12-16 h, pick a single colony and culture it on LB liquid medium with kanamycin resistance at 37°C for 12-16 h, collect 2-4 mL of fresh bacterial liquid, and extract plasmid according to the instructions of Qingke Plasmid Extraction Kit. Determine the concentration of the extracted plasmid in NANO and store it at -20°C for later use.

[0047] The diluted pk18mobsacB vector was used as a template, and the linearized pk18mobsacB vector was obtained by PCR using primers 21 and 22. The PCR reaction conditions were as follows: 95 °C for 5 min; 95 °C for 30 s, 56 °C for 30 s, 72 °C for 5min15 s, and 32 cycles. After verification by nucleic acid electrophoresis, DpnⅠ was added at 37 °C for 30 min to eliminate the template. After the backbone concentration was determined using NANO, it was stored at -20 °C for later use.

[0048] The obtained pqo upstream and downstream homology arms, panBC, panE and linearized pk18mobsacB vector were subjected to multi-fragment enzyme ligation using C115. The reaction system and conditions are as follows: Components Dosage μL C115 enzyme 5 Upstream homology arm 1 Downstream homology arm 1 BC 1 E 1 Linearized pk18mobsacB vector 1 After reacting at 50°C for 30 min, a ligation product was obtained, which was transformed into E. coli DH5α competent cells and cultured at 37°C overnight. After successful colony PCR verification, the recombinant plasmid pK18mobsacB-Δpqo::panBCE was obtained by picking bacteria in a test tube and extracting using a plasmid extraction kit according to Example 1. 10 μL of the plasmid was sent for sequencing and the remaining plasmid was stored at -20°C.

[0049] Preparation of DPA1 electroporation competent cells: Pick a single DPA1 colony and inoculate it into a small shake flask containing 10 mL LB medium, and culture it overnight at 30°C, 200 rpm. Pipette 1 mL of overnight culture solution and transfer it to a 250 mL conical flask containing 40 mL LB medium, and culture it at 30°C, 200 rpm for 6 hours until the OD value of the culture solution reaches 1. 600 Greater than 0.8. Cool the cultured bacterial solution on ice for about 20 minutes, pour it into a 50 mL centrifuge tube, centrifuge it at 4 °C, 5000 rpm for 10 min, remove the supernatant in a clean bench to retain the bacteria, add about 20 mL of pre-sterilized and pre-cooled 10% glycerol solution, resuspend it in an ice-water bath, centrifuge it at 4 °C, 5000 rpm for 5 min, repeat three times, add 1 mL of pre-cooled 10% glycerol, resuspend it in an ice-water bath, and dispense it into 1.5 mL sterile centrifuge tubes (100 μL per tube), keep one tube for later use, and store the rest at -80 °C.

[0050] Plasmid pK18mobsacB-Δpqo::panBCE was introduced into DPA1: 5 μL of pK18mobsacB-Δpqo::panBCE was added to the electroporation competent DPA1 and gently pipetted to mix. The culture was placed in an ice bath for 5 min. After two electric shocks at 1.8 kV, 1 mL of preheated 46 ℃ LB medium was added. Heat shock was immediately performed at 46 ℃ for 6 min, and then cultured at 30 ℃ and 200 rpm for two hours. The culture was spread on a kan resistance LB plate (single exchange screening) and cultured at 30 ℃ for 40 h. A single colony was picked to inoculate 10 mL of liquid kan-resistant LB medium and cultured for 12 hours. Then 1% of the volume was transferred to 10 mL of non-resistant LB liquid medium for relaxed culture for 12 hours. After that, the bacterial liquid was streaked onto LBS solid medium for the second screening (double exchange screening). A single colony was picked from the LBS medium to copy the kan-resistant and non-resistant LB solid medium. The strain that grew on the non-resistant plate and did not grow on the kan-resistant plate was selected as a template. Colony PCR with primers 23 and 24 was used to verify whether pqo was knocked out and whether panBCE was successfully integrated. The strain with the correct band was selected to inoculate 10 ml of LB liquid medium at 30 ℃ 200 rpm overnight, and then the bacteria were preserved and sent for sequencing. The strain with the correct sequencing was named DPA2.

[0051] Fermentation of strain DPA2: Taking DPA1 as the control strain, DPA1 and DPA2 were inoculated into 10 mL of LB medium and cultured at 30 °C and 200 rpm as seed solution; after 12 h, 1 mL of seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium, and then cultured at 30 °C and 180 rpm until the fermentation liquid reached OD 600 =0.8-1.0, add IPTG with a final concentration of 0.1 mM and continue to culture for 48 h; after the fermentation, take 1 mL of the fermentation liquid and centrifuge at 12000 rpm for 2 min at room temperature, take the supernatant and perform HPLC detection, and take another 1 mL of the fermentation liquid to measure the biomass OD 600 .

[0052] HPLC detection: (1) Chromatographic conditions: C18 column (250×4.6 mm, particle size 5μm, Agilent Technologies Co, Santa Clara, CA, USA); detection wavelength: 200 nm; column temperature: 30°C; (2) Sample treatment: dilute the sample with ultrapure water to keep the D-pantothenic acid content at 0.05-0.40 g / L; (3) Mobile phase: acetonitrile / water / phosphoric acid (volume ratio 50 / 949 / 1); (4) Data acquisition time: 15 min. This method was used for the detection of D-pantothenic acid in the following examples.

[0053] Example 3 Screening and expression of ilvBN gene In order to enhance the upstream pulling force of pantothenic acid and direct more carbon flow to the main synthesis pathway of D-pantothenic acid, the pEC-xk99E overexpression plasmid was introduced into the DPA2 strain of Corynebacterium glutamicum to screen and express acetohydroxyacid synthase (AHAS, ilvBN) from Escherichia coli W3110, Bacillus subtilis 168, endogenous acetohydroxyacid synthase (AHAS, ilvBN) and an acetohydroxyacid synthase mutant from Corynebacterium glutamicum ATCC 13032 itself, and the Corynebacterium glutamicum producer strain that efficiently produces D-pantothenic acid was obtained and applied to the fermentation production of D-pantothenic acid.

[0054] Acetohydroxyacid synthase (AHAS, ilvBN) from Escherichia coli W3110, Bacillus subtilis 168, Corynebacterium glutamicum ATCC 13032 and their mutants were overexpressed using the strong promoter Ptuf using pEC-xk99E.

[0055] The pEC-xk99E vector (plasmid from laboratory collection) was diluted and used as a template. Primers 25 and 26 were used to construct the pEC-xk99E series expression vector backbone capable of expressing the ilvBN gene by PCR. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 56 ℃ 30 s, 72 ℃ 5 min 15 s, 32 cycles; after the obtained PCR product was run on a gel to confirm that there was a bright and clear target band, DpnⅠ was added at 37 ℃ for 30 min to eliminate the template. After the backbone concentration was determined using NANO, it was stored at -20°C for later use.

[0056] Subsequently, primers 27 and 28 were used to amplify the endogenous ilvBN sequence of Corynebacterium glutamicum according to the ilvBN gene of Corynebacterium glutamicum ATCC 13032 published on NCBI. The PCR reaction conditions were as follows: 98°C for 10 min; 98°C for 30 s, 56°C for 30 s, 72°C for 1 min 30 s, 32 cycles; 72°C for 5 min. In the same way, primers 29 / 30 and primers 31 / 32 were used to amplify the ilvBN sequence of Escherichia coli and the ilvBN sequence of Bacillus subtilis. The PCR product was purified using a purification kit.

[0057] The linearized pEC-xk99E was used as a template by PCR, and the Ptuf strong promoter was introduced using primers 33 and 34. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 30 s, 56°C for 30 s, and 72°C for 5 min 30 s, for 32 cycles. The PCR product was purified using a purification kit.

[0058] The process of preparing competent E. coli by chemical transformation is as follows: pick a single colony of E. coli and inoculate it into a test tube containing 5 mL of LB medium, and culture it overnight at 37°C and 200 rpm in a constant temperature shaker. Pipette 1 mL of the overnight culture solution and transfer it to a 250 mL conical flask containing 40 mL of LB medium, and culture it at 37°C and 200 rpm in a constant temperature shaker for 1-2 hours until the OD value of the culture solution reaches 1. 600 The concentration of the cultured bacterial solution is between 0.4 and 0.6. Place the cultured bacterial solution on ice to cool for about 10 minutes, pour it into a 50 mL centrifuge tube, centrifuge it at 4 °C, 5500 rpm for 5 minutes, remove the supernatant and retain the bacteria in a clean bench, add about 40 mL of pre-sterilized and pre-cooled 0.1 M CaCl2 solution, resuspend it in an ice-water bath, and ice-bath it for 30 minutes. After centrifugation at 6000 rpm for 5 minutes, add 1 mL of pre-cooled 0.1 M CaCl2 and 15% glycerol, resuspend it in an ice-water bath, and dispense it into 1.5 mL sterile centrifuge tubes (100 μL per tube), keep one tube for later use, and store the rest at -80 °C.

[0059] The linearized pEC-xk99E vector with the Ptuf strong promoter introduced and the obtained ilvBN gene fragment were connected using C115, and the reaction conditions were as follows: 50°C for 30 min, take a competent E. coli and place it on ice, add the reaction product to the competent cell in a clean bench, place it on ice for 5 min, heat shock it at 42°C for 1 min, place it on ice for 3 min, add 700 μL of LB culture medium, culture it at 37°C for 1 h, take it out, centrifuge it at 5000 rpm for 2 min, then aspirate and discard 600 μL of LB culture medium, mix the rest by pipetting, and spread it all on LB solid culture medium (kan resistance), and culture it at 37°C overnight.

[0060] A single colony was selected as a template, and primers 35 and 36 were used for colony PCR verification. After the band was confirmed to be correct, it was sent to the company for sequencing. After sequencing was correct, the bacteria were re-shaken and plasmids were extracted. Plasmid extraction was performed using a plasmid extraction kit. The rest of the expression vectors were constructed as above.

[0061] The electroporated competent cells of Corynebacterium glutamicum were prepared as follows: a single colony of Corynebacterium glutamicum was inoculated into a small shake flask containing 10 mL of LB medium and cultured overnight at 30°C and 200 rpm. 1 mL of the overnight culture was transferred to a 250 mL conical flask containing 40 mL of LB medium and cultured at 30°C and 200 rpm for 6 hours until the OD value of the culture reached 0. 600 Greater than 0.8. Place the cultured bacterial solution on ice to cool for about 20 minutes, pour into a 50 mL centrifuge tube, centrifuge at 4°C, 5000 rpm for 10 minutes, remove the supernatant on a clean bench to retain the bacteria, add about 20 mL of pre-sterilized pre-cooled 10% glycerol solution, resuspend in an ice-water bath, centrifuge at 4°C, 5000 rpm for 5 minutes, repeat three times, add 1 mL of pre-cooled 10% glycerol, resuspend in an ice-water bath, and dispense into 1.5 mL sterile centrifuge tubes (100 μL per tube), keep one tube for later use, and store the rest at -80°C.

[0062] The electroporation process is as follows: Take an electroporation competent cell and place it in an ice bath. Add 3 μL of the overexpression vector in the clean bench, gently mix with a pipette, and place it in an ice bath for 5 min. Use a pipette to transfer to a pre-cooled 2mm electroporation cup and place it in an ice bath for 1 min. Use a paper towel to wipe off the water mist on the outside of the electroporation cup, place it in the electroporator, and use 1.8 kV electroporation. Add 1 mL of pre-cooled LB culture medium to the groove of the electroporation cup in the clean bench, tilt the electroporation cup, absorb all the bacterial liquid from the mouth of the electroporation cup, and transfer it to a 2 mL sterile ep tube. Resuscitate at 30℃, 200rpm for 3 h. Take 60 μL and spread it on LB solid culture medium (kan / 2 resistance) and culture at 30℃ for 36-72h.

[0063] Example 4 Screening and expression of ilvC gene In order to enhance the downstream pulling force of pantothenic acid and direct more carbon flow to the main synthesis pathway of D-pantothenic acid, the pEC-xk99E overexpression plasmid was introduced into the DPA2 strain of Corynebacterium glutamicum to screen the expression of Escherichia coli W3110, Bacillus subtilis 168, and endogenous acetolactate isomeroreductase (AHAIR, ilvC), and the Corynebacterium glutamicum producer strain that efficiently produces D-pantothenic acid was obtained and applied to the fermentation production of D-pantothenic acid.

[0064] Acetolactate isoreductisomerase (AHAIR, ilvC) from Escherichia coli W3110, Bacillus subtilis 168 and Corynebacterium glutamicum ATCC 13032 was overexpressed using the strong promoter Ptuf using pEC-xk99E.

[0065] The pEC-xk99E vector (plasmid from laboratory collection) was diluted and used as a template. Primers 25 and 26 were used to construct the pEC-xk99E series expression vector backbone that can express the ilvC gene by PCR. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 56 ℃ 30 s, 72 ℃ 5 min 15 s, 32 cycles; after the obtained PCR product was run on a gel to confirm that there was a bright and clear target band, DpnⅠ was added at 37 ℃ for 30 min to eliminate the template. After the backbone concentration was determined using NANO, it was stored at -20°C for later use.

[0066] Subsequently, primers 37 and 38 were used to amplify the endogenous ilvC sequence of Corynebacterium glutamicum according to the ilvC gene of Corynebacterium glutamicum ATCC 13032 published on NCBI. The PCR reaction conditions were as follows: 98°C for 10 min; 98°C for 30 s, 56°C for 30 s, 72°C for 1 min 30 s, 32 cycles; 72°C for 5 min. In the same way, primers 39 / 40 and primers 41 / 42 were used to amplify the ilvC sequence of Escherichia coli and the ilvC sequence of Bacillus subtilis. The PCR product was purified using a purification kit.

[0067] The linearized pEC-xk99E was used as a template by PCR, and the Ptuf strong promoter was introduced using primers 33 and 34. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 30 s, 56°C for 30 s, and 72°C for 5 min 30 s, for 32 cycles. The PCR product was purified using a purification kit.

[0068] The process of preparing competent E. coli by chemical transformation is as follows: pick a single colony of E. coli and inoculate it into a test tube containing 5 mL of LB medium, and culture it overnight at 37°C and 200 rpm in a constant temperature shaker. Pipette 1 mL of the overnight culture solution and transfer it to a 250 mL conical flask containing 40 mL of LB medium, and culture it at 37°C and 200 rpm in a constant temperature shaker for 1-2 hours until the OD value of the culture solution reaches 1. 600The concentration of the cultured bacterial solution is between 0.4 and 0.6. Place the cultured bacterial solution on ice to cool for about 10 minutes, pour it into a 50 mL centrifuge tube, centrifuge it at 4 °C, 5500 rpm for 5 minutes, remove the supernatant and retain the bacteria in a clean bench, add about 40 mL of pre-sterilized and pre-cooled 0.1 M CaCl2 solution, resuspend it in an ice-water bath, and ice-bath it for 30 minutes. After centrifugation at 6000 rpm for 5 minutes, add 1 mL of pre-cooled 0.1 M CaCl2 and 15% glycerol, resuspend it in an ice-water bath, and dispense it into 1.5 mL sterile centrifuge tubes (100 μL per tube), keep one tube for later use, and store the rest at -80 °C.

[0069] The linearized pEC-xk99E vector with the Ptuf strong promoter introduced and the obtained ilvC gene fragment were connected using C115, and the reaction conditions were as follows: 50°C for 30 min, take a competent E. coli and place it on ice, add the reaction product to the competent cell in a clean bench, place it on ice for 5 min, heat shock it at 42°C for 1 min, place it on ice for 3 min, add 700μL LB culture medium, culture it at 37°C for 1 h, take it out, centrifuge it at 5000 rpm for 2 min, then aspirate and discard 600μL LB culture medium, mix the rest by pipetting, and spread it all on LB solid culture medium (kan resistance), and culture it at 37°C overnight.

[0070] A single colony was selected as a template, and primers 35 and 36 were used for colony PCR verification. After the band was confirmed to be correct, it was sent to the company for sequencing. After sequencing was correct, the bacteria were re-shaken and plasmids were extracted. Plasmid extraction was performed using a plasmid extraction kit. The rest of the expression vectors were constructed as above.

[0071] The electroporated competent cells of Corynebacterium glutamicum were prepared as follows: a single colony of Corynebacterium glutamicum was inoculated into a small shake flask containing 10 mL of LB medium and cultured overnight at 30°C and 200 rpm. 1 mL of the overnight culture was transferred to a 250 mL conical flask containing 40 mL of LB medium and cultured at 30°C and 200 rpm for 6 hours until the OD value of the culture reached 0. 600 Greater than 0.8. Place the cultured bacterial solution on ice to cool for about 20 minutes, pour into a 50 mL centrifuge tube, centrifuge at 4°C, 5000 rpm for 10 minutes, remove the supernatant on a clean bench to retain the bacteria, add about 20 mL of pre-sterilized pre-cooled 10% glycerol solution, resuspend in an ice-water bath, centrifuge at 4°C, 5000 rpm for 5 minutes, repeat three times, add 1 mL of pre-cooled 10% glycerol, resuspend in an ice-water bath, and dispense into 1.5 mL sterile centrifuge tubes (100 μL per tube), keep one tube for later use, and store the rest at -80°C.

[0072] The electroporation process is as follows: Take an electroporation competent cell and place it in an ice bath. Add 3 μL of the overexpression vector in the clean bench, gently mix with a pipette, and place it in an ice bath for 5 min. Use a pipette to transfer to a pre-cooled 2mm electroporation cup and place it in an ice bath for 1 min. Use a paper towel to wipe off the water mist on the outside of the electroporation cup, place it in the electroporator, and use 1.8 kV electroporation. Add 1 mL of pre-cooled LB culture medium to the groove of the electroporation cup in the clean bench, tilt the electroporation cup, absorb all the bacterial liquid from the mouth of the electroporation cup, and transfer it to a 2 mL sterile ep tube. Resuscitate at 30℃, 200rpm for 3 h. Take 60 μL and spread it on LB solid culture medium (kan / 2 resistance) and culture at 30℃ for 36-72h.

[0073] Example 5 Screening and expression of ilvD gene In order to enhance the downstream pulling force of pantothenic acid and direct more carbon flow to the main synthesis pathway of D-pantothenic acid, the pEC-xk99E overexpression plasmid was introduced into the DPA2 strain of Corynebacterium glutamicum to screen for expression of Escherichia coli W3110, Bacillus subtilis 168, and endogenous 2-hydroxyacid dehydratase (DHAD, ilvD), and the Corynebacterium glutamicum producer strain that efficiently produces D-pantothenic acid was obtained and applied to the fermentation production of D-pantothenic acid.

[0074] pEC-xk99E was used to overexpress 2-hydroxyacid dehydratase (DHAD, ilvD) from Escherichia coli W3110, Bacillus subtilis 168 and Corynebacterium glutamicum ATCC 13032 using the strong promoter Ptuf.

[0075] The pEC-xk99E vector (plasmid from laboratory collection) was diluted and used as a template. Primers 25 and 26 were used to construct the pEC-xk99E series expression vector backbone capable of expressing the ilvD gene by PCR. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 56 ℃ 30 s, 72 ℃ 5 min 15 s, 32 cycles; after the obtained PCR product was run on a gel to confirm that there was a bright and clear target band, DpnⅠ was added at 37 ℃ for 30 min to eliminate the template. After the backbone concentration was determined using NANO, it was stored at -20°C for later use.

[0076] Subsequently, primers 43 and 44 were used to amplify the endogenous ilvD sequence of Corynebacterium glutamicum according to the ilvD gene of Corynebacterium glutamicum ATCC 13032 published on NCBI. The PCR reaction conditions were as follows: 98°C for 10 min; 98°C for 30 s, 56°C for 30 s, 72°C for 1 min 30 s, 32 cycles; 72°C for 5 min. In the same way, primers 45 / 46 and primers 47 / 48 were used to amplify the ilvD sequence of Escherichia coli and the ilvD sequence of Bacillus subtilis. The PCR product was purified using a purification kit.

[0077] The linearized pEC-xk99E was used as a template by PCR, and the Ptuf strong promoter was introduced using primers 33 and 34. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 30 s, 56°C for 30 s, and 72°C for 5 min 30 s, for 32 cycles. The PCR product was purified using a purification kit.

[0078] The process of preparing competent E. coli by chemical transformation is as follows: pick a single colony of E. coli and inoculate it into a test tube containing 5 mL LB medium, and culture it overnight at 37 ℃ and 200 rpm in a constant temperature shaker. Pipette 1 mL of overnight cultured bacterial solution and transfer it to a 250 mL conical flask containing 40 mL LB medium, and culture it at 37 ℃ and 200 rpm in a constant temperature shaker for 1-2 hours until the OD600 of the bacterial solution is 0.4-0.6. Place the cultured bacterial solution on ice to cool for about 10 minutes, pour it into a 50 mL centrifuge tube, centrifuge it at 4 ℃ and 5500 rpm for 5 minutes, remove the supernatant and retain the bacteria in the clean bench, add about 40 mL of pre-sterilized pre-cooled 0.1 M CaCl2 solution, resuspend it in an ice water bath, and ice bath it for 30 minutes. After centrifugation at 6000 rpm for 5 min, add 1 mL of pre-cooled medium containing 0.1 M CaCl2 and 15% glycerol, resuspend in an ice-water bath, and dispense into 1.5 mL sterile centrifuge tubes (100 μL per tube), keep one tube for later use, and store the rest at -80°C.

[0079] The linearized pEC-xk99E vector with the Ptuf strong promoter introduced and the obtained ilvD gene fragment were connected using C115, and the reaction conditions were as follows: 50°C for 30 min, take a competent E. coli and place it on ice, add the reaction product to the competent cell in a clean bench, place it on ice for 5 min, heat shock it at 42°C for 1 min, place it on ice for 3 min, add 700μL LB culture medium, culture it at 37°C for 1 h, take it out, centrifuge it at 5000 rpm for 2 min, then aspirate and discard 600μL LB culture medium, mix the rest by pipetting, and spread it all on LB solid culture medium (kan resistance), and culture it at 37°C overnight.

[0080] A single colony was selected as a template, and primers 35 and 36 were used for colony PCR verification. After the band was confirmed to be correct, it was sent to the company for sequencing. After sequencing was correct, the bacteria were re-shaken and plasmids were extracted. Plasmid extraction was performed using a plasmid extraction kit. The rest of the expression vectors were constructed as above.

[0081] The electroporated competent cells of Corynebacterium glutamicum were prepared as follows: a single colony of Corynebacterium glutamicum was inoculated into a small shake flask containing 10 mL of LB medium and cultured overnight at 30°C and 200 rpm. 1 mL of the overnight culture was transferred to a 250 mL conical flask containing 40 mL of LB medium and cultured at 30°C and 200 rpm for 6 hours until the OD value of the culture reached 0. 60 0 is greater than 0.8. Place the cultured bacterial solution on ice to cool for about 20 minutes, pour into a 50 mL centrifuge tube, centrifuge at 4 °C, 5000 rpm for 10 min, remove the supernatant on a clean bench to retain the bacteria, add about 20 mL of pre-sterilized pre-cooled 10% glycerol solution, resuspend in an ice-water bath, centrifuge at 4 °C, 5000 rpm for 5 min, repeat three times, add 1 mL of pre-cooled 10% glycerol, resuspend in an ice-water bath, and dispense into 1.5 mL sterile centrifuge tubes (100 μL per tube), keep one tube for later use, and store the rest at -80 °C.

[0082] The electroporation process is as follows: Take an electroporation competent cell and place it in an ice bath. Add 3 μL of the overexpression vector in the clean bench, gently mix with a pipette, and place it in an ice bath for 5 min. Use a pipette to transfer to a pre-cooled 2mm electroporation cup and place it in an ice bath for 1 min. Use a paper towel to wipe off the water mist on the outside of the electroporation cup, place it in the electroporator, and use 1.8 kV electroporation. Add 1 mL of pre-cooled LB culture medium to the groove of the electroporation cup in the clean bench, tilt the electroporation cup, absorb all the bacterial liquid from the mouth of the electroporation cup, and transfer it to a 2 mL sterile ep tube. Resuscitate at 30℃, 200rpm for 3 h. Take 60 μL and spread it on LB solid culture medium (kan / 2 resistance) and culture at 30℃ for 36-72h.

[0083] Example 6 Tandem expression of ilvBNCD genes In order to enhance the downstream pulling power of the strain and direct more metabolic flux toward D-pantothenic acid synthesis, the ilvBN, ilvC, and ilvD genes screened out by shake flask fermentation were expressed in tandem using pEC-xk99E.

[0084] Using Corynebacterium glutamicum ATCC 13032 as a template, using primers 49 and 50, a target gene ilvBN capable of being expressed was constructed by PCR; using Bacillus subtilis 168 as a template, using primers 51 and 52, a target gene ilvC capable of being expressed was constructed by PCR; using Escherichia coli W3110 as a template, using primers 53 and 54, a target gene ilvD capable of being expressed was constructed by PCR. The PCR reaction conditions, vector construction process and electrotransduction process were the same as those in Example 1.

[0085] Table 1 Primer list Primer 1 ggactgagctagctgtcaatctCGTTGTTGCCACCAGAGATG Primer 2 CTAGGAGAAGATTACACTAGTCAACCGTGAGTGAAACATACGTGTCTGAGAAAG Primer 3 TTTTCTCAGACACGTATGTTTCACTCACGGTTGACTAGTGTAATCTTCTCCTAG Primer 4 aaaagtagaacaactgttcacctGTGGGGAGACAATGGAACCAATC Primer 5 aggtgaacagttgttctacttttg Primer 6 agattgacagctagctcagtcc Primer 7 GACACGTATGTTTCACTCATatctacaacagtagaaattcggatcc Primer 8 ATGAGTGAAACATACGTGTCatttaaataaaacgaaaggctcagtcg Primer 9 agagtttgtagaaacgcaaaaagg Primer 10 gtgacatgcaaagtaagcatgatctc Primer 11 CGTCATTGCGTCCACTGACTGTG Primer 12 CCGCACAAACAGGCATCCCACG Primer 13 GGCTGTTTTGGCGGATGAGAG Primer 14 CATGGTCTGTTTCCTGTGTGAA Primer 15 AAGACCATGAAGGAGATATAGATGCCCATGTCAGGCATTGA Primer 16 TCTCATCCGCCAAAACAGCCCTAGAGCTCGATATTGTCGATCAACC Primer 17 AAGACCATGAAGGAGATATAGATGAAAACCGACCACCATCTCC Primer 18 TCTCATCCGCCAAAACAGCCTTACGCCAGCTCGACCATTTTG Primer 19 AAGACCATGAAGGAGATATAGATGAAAACAAAACTGGATTTTCTAAAAAATGAAGG Primer 20 ATCCCGCCAAAACAGCCTTATATTCTCTCCATTTCTCGAATATCAATAATGATATTATCT Primer 21 AAGACCATGAAGGAGATATAGATGAAAATTGCGATCGTTGGCG Primer 22 CTCTCATCCGCCAAAACAGCCCTAAAGTGAATTTTCCTCTTCTTTCAGCTT Primer 23 AAGACCATGAAGGAGATATAGATGAAAATTACCGTATTGGGATGCG Primer 24 TCATCCGCCAAAACAGCCCTACCAGGGGCGAGGCAAA Primer 25 GGCTGTTTTGGCGGATGAGAG Primer 26 CATGGTCTGTTTCCTGTGTGAA Primer 27 AAGACCATGAAGGAGATATAGTTGACAAAAGCAACAAAAGAACAAAAATCC Primer 28 CATCCGCCAAAACAGCCCTAGAGAGCTTCGTTTTCATGAGTTC Primer 29 AAGACCATGAAGGAGATATAGGTGAATGTGGCAGCTTCTCAAC Primer 30 TCATCCGCCAAAACAGCCTTAGATCTTGGCCGGAGCCATG Primer 31 TTAAGACCATGAAGGAGATATAGATGGCAAGTTCGGGCACAAC Primer 32 CATCCGCCAAAACAGCCTTACTGAAAAAACACCGCGATCTTG Primer 33 GGCGTTGATTTTCAAACTACCAGCTACCCTGTGGACATTCATGGTCTGTTTCCTGTGTG Primer 34 TATCTCCTTCATGGTCTTACTGAATCCTAAGGGCAACGGCGTTGATTTTCAAACTACCA Primer 35 CATCCGGCTCGTATAATGTGTGG Primer 36 CAGACCGCTTCTGCGTTCTG Primer 37 AAGACCATGAAGGAGATATAGATGGCAGAATTACGCAGTAATATGATC Primer 38 TCTCTCATCCGCCAAAACAGCCCTAGATTTTCATAATACCGCCGGTG Primer 39 AAGACCATGAAGGAGATATAGatgatcccacttcgttcaaaagtcac Primer 40 CTTCTCTCATCCGCCAAAACAGCCttagtcgacctgacggactg Primer 41 AAGACCATGAAGGAGATATAGATGCCTAAGTACCGTTCCGC Primer 42 CTTCTCTCATCCGCCAAAACAGCCTTAACCCCCCAGTTTCGATTTATCG Primer 43 GACCATGAAGGAGATATAGATGGTAAAAGTATATTATAACGGTGATATCAAAGAGAACG Primer 44 CTCTCATCCGCCAAAACAGCCTTAATTTTGCGCAACGGAGACC Primer 45 AAGACCATGAAGGAGATATAGATGGCTATTGAACTGCTTTATGATGC Primer 46 CTCTCATCCGCCAAAACAGCCTTAAGCGGTTTCTGCGCGAG Primer 47 AAGACCATGAAGGAGATATAGATGGCTAACTACTTCAATACACTGAATCTG Primer 48 CTCTCATCCGCCAAAACAGCCTTAACCCGCAACAGCAATACGTT Primer 49 AAGACCATGAAGGAGATATAGGTGAATGTGGCAGCTTCTCAAC Primer 50 CTTCTCTCATCCGCCAAAACAGCCTTAGATCTTGGCCGGAGCCATG Primer 51 CGATAAGCTGGAAGATGTCGTGAAAGTGGACCATGAAGGAGATATAGATGGTAAAAG Primer 52 TCTATATCTCCTTCATGGTCTTAATTTTGCGCAACGGAGACCACCGCTTCCTTCTTCT Primer 53 TCTCCGTTGCGCAAAATTAAGACCATGAAGGAGATATAGATGCCTAAGTACCGTTCCGC Primer 54 AAATCTTCTCTCATCCGCCAAAACAGCCTTAACCCCCCAGTTTCGATTTATCGCGCA Example 7 Shake flask fermentation experiment of attenuated strain of ilvA gene Table 2 D-pantothenic acid production of each genotype strain in shake flask fermentation strains genotype D-pantothenic acid production (g / L) WT Wild Type 0 DPA1 WT, ilvA(GTG) 0.1 According to Table 2, the metabolically modified Corynebacterium glutamicum strains have the ability to produce and accumulate D-pantothenic acid outside the cell, and can better utilize carbon sources such as glucose to produce D-pantothenic acid than the wild type. The strain with the best performance after modification has an increase in the level of D-pantothenic acid production from almost no pantothenic acid to 0.1 g / L compared to the starting strain.

[0086] Example 8 Shake flask fermentation experiment of panBCE gene integration expression Table 3 D-pantothenic acid production of each genotype strain in shake flask fermentation strains genotype D-pantothenic acid production (g / L) DPA1 WT, ilvA(GTG) 0.1 DPA2 DpA1,Δpqo::BCE 0.3 According to Table 3, the metabolically modified Corynebacterium glutamicum strains have the ability to produce and accumulate D-pantothenic acid outside the cell, and can better utilize carbon sources such as glucose to produce D-pantothenic acid than the wild type. The strain with the best performance after modification increased the level of D-pantothenic acid fermentation production from 0.1 g / L to 0.3 g / L compared with the starting strain.

[0087] Example 9 Screening and tandem expression of ilvBNCD gene in shake flask fermentation experiment The stability performance of the constructed D-pantothenic acid production strain was tested. The strain was streaked on LB plates and cultured overnight in a 30°C incubator. A single colony was picked and inoculated into 10 mL of LB medium and cultured at 30°C for 14 h. Then 1 mL of the test tube culture was inoculated into a 500 mL Erlenmeyer flask containing 50 mL of fermentation medium. The fermentation medium (g·L -1 ) The final concentration composition is: glucose 30, corn syrup 25, ammonium sulfate 15, ammonium acetate 15, urea 2, sodium citrate 2, K2HPO4·3H2O1.3, MgSO4·7H2O0.5, L-isoleucine 0.06, MnSO4·H2O0.01, biotin 1x10 -4 , Thiamine 2x10 -4 , CaCO330, pH7.0-7.2. Sterilize at 115℃ for 10 min.

[0088] Table 4 D-pantothenic acid production of each genotype strain in shake flask fermentation strains genotype D-pantothenic acid production (g / L) DPA2-1 DPA2, pEC-XK99E- () 0.31 DPA2-2 DPA2, pEC-XK99E- () 0.42 DPA2-3 DPA2, pEC-XK99E- () 0.25 DPA2-4 DPA2, pEC-XK99E- () 0.71 DPA2-5 DPA2, pEC-XK99E- () 0.31 DPA2-6 DPA2, pEC-XK99E- () 0.69 DPA2-7 DPA2, pEC-XK99E- () 0.62 DPA2-8 DPA2, pEC-XK99E- () 0.25 DPA2-9 DPA2, pEC-XK99E- () 0.58 DPA2-10 DPA2, pEC-XK99E- () 0.16 DPA2-11 DPA2, pEC-XK99E- () 0.21 DPA3 DPA2, pEC-XK99E-ilvBN(Cg)C(B.su)D() 0.94 According to Table 4, the metabolically modified Corynebacterium glutamicum strains have the ability to produce and accumulate D-pantothenic acid outside the cell, and can better utilize carbon sources such as glucose to produce D-pantothenic acid than the wild type. The strain with the best performance after modification increased the level of D-pantothenic acid fermentation production from 0.3 g / L to 0.94 g / L compared with the starting strain.

[0089] Example 10 Screening and tandem expression of ilvBNCD genes Fermentation test in a 5 L fermenter The optimal strain DPA3 in the shake flask test was selected to test the D-pantothenic acid production performance in a 5L fermenter. The strain was streaked on an LB plate and cultured overnight in a 30°C incubator. A single colony was picked and inoculated into 10 ml of LB medium and cultured at 30°C for 14 h. Then 1 ml of the small shake flask culture was inoculated into a 500 ml triangular flask containing 100 ml of seed (LB liquid) medium and cultured in a 30°C incubator at 200 rpm for 14 h. 200 ml of the seed culture was inoculated into a 5 L fermenter (BIOTECH-5JG) containing 1.5 L of fermentation medium. The feed medium was added by the fed-batch method, and the fermentation cycle was 50-100 h. During the fermentation process, the glucose concentration was controlled at 1-5 g / L by feeding. The DO level was controlled at about 20% during the fermentation process by stirring coupled dissolved oxygen (DO) mode, the stirring speed was controlled at 300–600 rpm, the aeration rate was controlled at 1–2 vvm, the culture temperature was controlled at 30°C during the fermentation process, and the pH was adjusted to 6.8±0.2 with 50% ammonia water. The fermentation medium composition was: glucose 30, corn steep liquor 25, ammonium sulfate 15, ammonium acetate 15, urea 2, sodium citrate 2, K2HPO4·3H2O1.3, MgSO4·7H2O0.5, L-isoleucine 0.06, MnSO4·H2O0.01, biotin 1x10 -4 , Thiamine 2x10 -4 , CaCO330, pH7.0-7.2. Sterilize at 115℃ for 10 min. The fermentation curve during the fermentation process is shown in Figure 3 ,according to Figure 3 It can be seen that after 80 h, the yield of D-pantothenic acid was 11.9 g / L and the sugar-acid conversion rate was 0.109 g / g.

Claims

1. A method for constructing Corynebacterium glutamicum that efficiently produces D-pantothenic acid, characterized in that: The specific steps include: (1) Using wild-type Corynebacterium glutamicum ATCC 13032 as the chassis, ilvA was weakened and mutant expression was constructed to construct DPA1; (2) Knock out pyruvate quinone oxidoreductase and insert a panBCE gene expression cassette into it to construct DPA2; (3) The pEC-xk99E overexpression plasmid was introduced into DPA2 to screen for the expression of Escherichia coli W3110, Bacillus subtilis 168, and endogenous acetohydroxyacid synthase, acetolactate isomeroreductisomerase, and 2-hydroxyacid dehydratase; (4) The selected ilvBNCD gene was overexpressed in tandem by pEC-xk99E under the control of a strong promoter to construct DPA3, thereby strengthening the main pantothenic acid synthesis pathway and the pulling force of the upstream pathway, thereby obtaining the Corynebacterium glutamicum that efficiently produces D-pantothenic acid.

2. The method for constructing Corynebacterium glutamicum for efficiently producing D-pantothenic acid according to claim 1, characterized in that: The start codon of ilvA in wild-type Corynebacterium glutamicum ATCC 13032 was changed from ATG to GTG.

3. The method for constructing Corynebacterium glutamicum for efficiently producing D-pantothenic acid according to claim 1, characterized in that: The panB, panC and panE are all integrated into the pyruvate quinone oxidoreductase gene site.

4. The method for constructing Corynebacterium glutamicum for efficiently producing D-pantothenic acid according to claim 3, characterized in that: The panB and panC integrated into the pqo gene site are derived from Corynebacterium glutamicum ATCC 13032, and panE is derived from Escherichia coli W3110; the ilvBN is derived from Corynebacterium glutamicum ATCC 13032, the ilvC is derived from Bacillus subtilis 168, and the ilvD is derived from Escherichia coli W3110.

5. The method for constructing Corynebacterium glutamicum for efficiently producing D-pantothenic acid according to claim 1, characterized in that: The panB, panC, panE, ilvBN, ilvC and ilvD are all expressed by a strong promoter.

6. The method for constructing Corynebacterium glutamicum for efficiently producing D-pantothenic acid according to claim 5, characterized in that: The strong promoter is Ptuf, and its nucleotide sequence is SEQ ID NO.

1.

7. A Corynebacterium glutamicum that efficiently produces D-pantothenic acid, characterized in that: It is prepared by the method according to any one of claims 1 to 6.

8. Use of the D-pantothenic acid-producing Corynebacterium glutamicum as claimed in claim 7 in the fermentation production of D-pantothenic acid.

9. The use according to claim 8, characterized in that The fermentation production process adopts the electrotransformation method.

10. The use according to claim 9, characterized in that The application is to inoculate the Corynebacterium glutamicum into a fermentation medium, perform fermentation and culture under suitable conditions, and separate and purify the culture fluid to obtain D-pantothenic acid.

Images