Application of long-chain non-coding RNA (Ribonucleic Acid) in regulation and control of proliferation and differentiation of neural stem cells

Abstract

The invention discloses a long-chain non-coding RNA (Ribonucleic Acid) Link-NSC, shRNA (Short Hairpin Ribonucleic Acid) for interfering the expression of the Link-NSC, and application of an interference vector containing the Link-NSC in neural stem cell differentiation. The Link-NSC provided by the invention can be used for remarkably promoting the differentiation of neural stem cells, inducing cell apoptosis and reducing cell proliferation; the Link-NSC expression is knocked down under the in-vitro condition, proliferation of the neural stem cells can be promoted, differentiation and apoptosis of the neural stem cells can be inhibited, and a new means is provided for patients needing stem cell transplantation treatment.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and more specifically, relates to an application of long-chain non-coding RNA in regulating the proliferation and differentiation of neural stem cells. Background Art

[0002] Long noncoding RNA (lncRNA) is a long noncoding RNA molecule with a length of more than 200 nucleotides that does not have the typical function of encoding proteins. Long intergenic noncoding RNA (lincRNAs) refers to a class of lncRNAs located between two coding genes. lncRNAs regulate gene expression at multiple levels, including epigenetics, transcription, and post-transcriptional levels, playing a vital role.

[0003] Neural stem cells (NSCs) are a type of cell population that has a strong self-renewal capacity and the potential to differentiate into neurons, astrocytes and oligodendrocytes, and can provide a large number of brain tissue cells. Stem cell therapy is a promising therapeutic strategy. The main challenges associated with NSC transplantation involve the regulation of stem cell survival, proliferation and differentiation after transplantation. Although cell transplantation has potential therapeutic effects, its overall efficacy is seriously hampered by significant cell death and limited tissue repair capacity of transplanted cells. In view of the urgent need to improve the survival rate of NSC transplantation, it is particularly important to study the role of lncRNA in NSC tumorigenicity, multipotency and neurogenesis. To date, there are few reports on lncRNA studies that regulate the proliferation, differentiation and apoptosis of neural stem cells. Therefore, how to find efficient lncRNAs that regulate the proliferation, differentiation and apoptosis of neural stem cells is very important, and it is also a problem that the present invention urgently needs to solve. Summary of the invention

[0004] In response to at least one defect or improvement need in the prior art, the present invention provides a new application of long non-coding RNA Linc-NSC in regulating the proliferation and differentiation of neural stem cells. It is highly expressed in neural stem cells. Functional verification shows that Linc-NSC can efficiently induce cell apoptosis and promote the differentiation of neural stem cells, and reduce the proliferation of stem cells. The research of this application will help to improve the research related to the safety and effectiveness of transplanted stem cells, and provide a new target for gene manipulation therapy for patients who need transplanted stem cell therapy.

[0005] The present invention provides an application of a long-chain non-coding RNA in regulating the proliferation and differentiation of neural stem cells. The nucleotide sequence of the long-chain non-coding RNA is shown in SEQ ID NO:1.

[0006] Preferably, it also includes shRNA and an interference vector that interfere with the expression of the long non-coding RNA, and the shRNA includes an interference sequence siRNA, and its nucleotide sequence is: GGGCCTCTATCAAGCCCATAA.

[0007] Preferably, the sense sequence of the shRNA is:

[0008] GATCCGGGCCTCTATCAAGCCCATAATTCAAGAGATTATGGGCTTGATAGAGGCCCTTTTTTG;

[0009] The antisense sequence of the shRNA is:

[0010] AATTCAAAAAAGGGCCTCTATCAAGCCCATAATCTCTTGAATTATGGGCTTGATAGAGGCCCG.

[0011] Preferably, the interference vector is an adenovirus expression vector or a lentivirus expression vector

[0012] Preferably, the interference vector is pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO.

[0013] Preferably, the shRNA sequence is inserted into the MCS downstream of the CMV promoter of the interference vector, and its restriction sites include BamHI, EcoRI, XhoI and XbaI.

[0014] According to the second aspect of the present invention, a fluorescent quantitative PCR kit for detecting the above-mentioned long non-coding RNA is also provided, the kit comprising: a forward primer, a reverse primer, and SYBR Green Master; wherein the nucleotide sequences of the forward primer and the reverse primer are as follows:

[0015] Forward primer: GGAAGTGAGGAGAGGGCTATT

[0016] Reverse primer: CATGATGTCTGTGTGTAGCTGA.

[0017] According to the second aspect of the present invention, there is also provided a use of the above-mentioned kit in regulating the proliferation and differentiation of neural stem cells.

[0018] According to the third aspect of the present invention, a method for regulating the proliferation and differentiation of neural stem cells for non-therapeutic purposes is also provided, comprising overexpressing the above-mentioned long non-coding RNA in neural stem cells, or knocking down the expression of the above-mentioned long non-coding RNA in neural stem cells.

[0019] In general, the above technical solutions conceived by the present invention can achieve the following beneficial effects compared with the prior art:

[0020] The present invention provides an application of a long non-coding RNA Linc-NSC, a shRNA interfering with Linc-NSC expression, and an interference vector containing Linc-NSC in regulating the proliferation and differentiation of neural stem cells. The Linc-NSC provided by the present invention is derived from neural stem cells and is the first to be found to be applicable to regulating the proliferation, differentiation and apoptosis of neural stem cells. Experiments have shown that Linc-NSC significantly promotes the differentiation of neural stem cells, induces cell apoptosis and reduces cell proliferation; knocking down Linc-NSC expression under in vitro conditions can significantly promote the proliferation of neural stem cells, inhibit their differentiation and apoptosis, and promote cell survival. The present invention provides a new means for patients who need stem cell transplantation therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The cell doubling time analysis of the shRNA group and the shRNA control group provided in the embodiment of the present invention; the population doubling time of the shRNA cells is less than 24 hours, and the population doubling time of the shRNA control cells is about 72 hours;

[0022] Figure 2 Statistical graphs evaluating stemness maintenance and neural orientation analysis for the shRNA and shRNA control groups;

[0023] Figure 3 Flow cytometry analysis of single cell suspensions in the shRNA group and shRNA control group;

[0024] Figure 4 Images of neurospheres in adherent culture immunostained with Nestin and differentiation markers (GFAP, NeuN, and Olig2); (green, Nestin staining; purple, GFAP staining; red, NeuN staining; orange, Olig2 staining; blue, DAPI. Scale bar = 20 µm. (n = 5, Student t test, *p < 0.05, **p < 0.01, ***p < 0.001);

[0025] Figure 5 is a graph showing the survival effect of neural stem cell transplantation in mice after the shRNA group and the shRNA control group provided in the embodiment of the present invention were transplanted respectively; wherein,

[0026] Figure 5 A is a schematic diagram of the present invention's embodiment of transplanting mice to verify the survival effect of neural stem cell transplantation;

[0027] Figure 5B is the overall appearance of the mouse brain after transplantation in the shRNA group and the shRNA control group;

[0028] Figure 5 C is the HE staining of the transplanted grafts at 2 weeks (×10, ×200) and 4 weeks (×10, ×200) after transplantation;

[0029] Figure 5 D is a fluorescent imaging image of green fluorescence imaging of serial sections to detect GFP-labeled cells. The injection needle track is indicated by an arrow. Scale bar = 100 μm.

[0030] Figure 5 E is a quantitative statistical graph of the number of surviving transplanted cells (n=5, Student t test, ****p<0.0001, no statistically significant difference, indicated by “ns”). DETAILED DESCRIPTION

[0031] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0032] The inventors have conducted relevant experimental studies to evaluate tumorigenicity by stereotactic transplantation of neural stem cells (NSC) and embryonic stem cells (ESC) in experimental mice. After 4 weeks, there was no evidence of tumor formation or long-term implantation in the NSC transplantation group. In contrast, due to the high proliferation capacity of ESC, the transplantation of ESC caused tumor formation. Based on transcriptome sequencing, it was found that the expression level of a long intergenic non-coding RNA with unknown structure and function on chromosome 16 in NSC was 1100 times that of ESC. Due to the amazing evolutionary conservation of LincRNA sequence and central nervous system-specific expression pattern, it was named Linc-NSC.

[0033] The present invention provides a long non-coding RNA, named Linc-NSC, whose nucleotide sequence is shown in SEQ ID NO: 1; in an embodiment of the present invention, the nucleotide sequence of the long non-coding RNA Linc-NSC is obtained by isolating from neural stem cells.

[0034] SEQ ID NO: 1:

[0035] GGCTTTGAAAACTATAACGTCTTGATTATTAATGTACAAACAGACTACAAGATTTCTGAAATTATCAGTGATGGCTCCTAATTGTACTTCCATTTACTTTCATGGGCCTTGTCCAAAGTAGGTACTAAAAGGCAAAGAAGAAAACCAGGAAGAAAGGACACA GTAGAGTTACTCAAAATGTCATACATATGTATGGGTCTTTCTTACTTCAAGTGAGAGCTACATAAATCCAAGGGCCTCTATCAAGCCCATAATCCTTGGTGACTACCTTTGATTGCGTGCTCATTCAAAACGCTGAGCACCCCATGGGAATGTGTTGAGAAAAT TCCTAGCAGCCCCTGAGCAGAGCCATCAGAGCAAGAGAGCGAGAGAGCAAGAGCGCTCTTTTCTAGCAAGGGTGCTGGGAAGTGAGGAGAGGGCTATTTCTAGAGATCACATTGCAAGGGAGCTAATCAGACATTCCATGGGTAGTGACAACCAGCAATTTAT TGGTGATGCTTCTCAGCTCAAAGGAACAGCAGGGTGTGACAAGAACAGTTTGCTCAGCTACACACAGACATCATGGTTTACTCTTGGATTAAAAAAAAAAAATTAACCGTGCTTATTTTGGCAAAAAGAAAGAAGAAAAAAAGAAAAAAAAAAGAAAACCTCTCAG

[0036] The present invention also provides shRNA that interferes with the expression of Linc-NSC. The secondary structure of Linc-NSC of the present invention is analyzed using RNA secondary structure prediction tools (such as RNAfold, mfold), and interference targets that interfere with the expression of Linc-NSC are predicted and designed. The nucleotide sequences of the sense sequence and antisense sequence of the shRNA finally screened are as follows:

[0037] Top strand:

[0038] GATCCGGGCCTCTATCAAGCCCATAATTCAAGAGATTATGGGCTTGATAGAGGCCCTT TTTTG

[0039] Bottom strand:

[0040] AATTCAAAAAAGGGCCTCTATCAAGCCCATAATCTCTTGAATTATGGGCTTGATAGAGGCCCG.

[0041] The shRNA was commissioned to be synthesized by Hanbio Biotech (Shanghai) Co., Ltd.

[0042] In the shRNA sequence, the applicant designed an interfering sequence siRNA and a loop structure that are directly embedded in the shRNA. The siRNA sequence is GGGCCTCTATCAAGCCCATAA, which is used for shRNA to exert a gene knockdown effect in cells; the loop structure sequence is TTATGGGCTTGATAGAGGCCC, which is used to connect the sense chain and the antisense chain. This loop structure design can form a stable hairpin structure; secondly, a specific restriction site such as BamHI / EcoRI is added to the 5' end of the shRNA sequence to facilitate cloning into a recombinant vector, and a termination signal (such as TTTTT) is added to ensure the effective expression and stability of the shRNA.

[0043] The present invention also provides an interference vector containing Linc-NSC, and the vector is preferably an adenovirus expression vector or a lentivirus expression vector. In a preferred embodiment, the interference vector selected is pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO, wherein CMV and U6 are gene promoters, MCS is a multiple cloning site, PURO is a resistance gene fragment, ZsGreen is a green fluorescent protein gene, and PGK- is a self-cleaving peptide sequence. The Linc-NSC is preferably inserted into the BamHI / EcoRI multiple cloning site of the overexpression vector.

[0044] The present invention is further described below through specific embodiments.

[0045] Example 1 Construction of Linc-NSC interference recombination vector

[0046] Primer3 software was used to design amplification primers based on the DNA sequence of Linc-NSC. The specific sequences are as follows:

[0047] 1.1 Synthesis of shRNA to interfere with Linc-NSC expression

[0048] According to the nucleotide sequence of Linc-NSC, amplification primers containing BamHI and EcoRI restriction sites were designed using Primer3 software. The specific sequences are as follows:

[0049] Forward Primer:

[0050] GATCCGGGCCTCTATCAAGCCCATAATTCAAGAGATTATGGGCTTGATAGAGGCCCTTTTTTG

[0051] Reverse Primer:

[0052] AATTCAAAAAAGGGCCTCTATCAAGCCCATAATCTCTTGAATTATGGGCTTGATAGAGGCCCG

[0053] The amplification primers of Linc-NSC were commissioned to be synthesized by Hanheng Biotechnology (Shanghai) Co., Ltd.

[0054] The PCR reaction program was 95℃ pre-denaturation for 5min; then 94℃ denaturation for 60s; 53℃ annealing for 40s; 72℃ extension for 60s. A total of 40 cycles. After the PCR reaction was completed, the target gene fragment was recovered by agarose electrophoresis and gel cutting.

[0055] 1.2 Vector digestion and ligation

[0056] pHBLV-CMV-MCS-EF1-ZsGreen-T2A-puro (designed and packaged by "Hanheng Biotechnology (Shanghai) Co., Ltd.") was used as the backbone vector. Two restriction endonucleases, BamHI and EcoRI, were selected to digest the backbone vector. The digestion was carried out at 37°C for 2 hours. The 50 μL digestion system included:

[0057] 5 μL of target gene fragment / vector, 5 μL of 10× tool enzyme buffer, 5 μL of BamHI enzyme, 5 μL of EcoRI enzyme, 30 μL of ddH2O. Recover the target gene fragment / vector using a DNA gel recovery kit. Use T4 DNA ligase to ligate the target gene fragment obtained by enzyme digestion and the linearized vector. The ligation reaction system is:

[0058] Incubate at 45°C for 2 h. 50 μL of ligation system includes: 5 μL of 10×T4 DNA ligase buffer, 5 μL of linearized vector, 5 μL of target gene fragment, 5 μL of T4 DNA ligase, and 30 μL of ddH2O.

[0059] Example 2 Neural stem cell culture and suspension transfection

[0060] 2.1 Isolation and culture of neural stem cells

[0061] 1) Experimental preparation:

[0062] Mice to be delivered, isoflurane, buffer (1xHBSS), trypsin, PBS, cell culture medium, DNA enzyme, cytokine, 75% alcohol, 40μm filter, scissors, tweezers, sterile bacterial culture dishes, stereo digital microscope, centrifuge tubes (50ml / 15ml), ice plates, EP tubes, etc.

[0063] 2) Operation steps:

[0064] (1) Place the experimental materials separately in the clean bench and sterilize them with ultraviolet light for 30 minutes.

[0065] (2) Transfer an appropriate amount of buffer solution into the bacterial culture dish, just enough to cover the entire dish. Take another 50ml centrifuge tube, pour 2 / 3 alcohol into it (just enough to cover the instruments), and place the dissecting instruments into it for disinfection; take another 50ml centrifuge tube, pour 2 / 3 buffer solution into it (to wash off the alcohol on the instruments).

[0066] (3) Remove the pregnant mouse and kill it by dislocating its cervical vertebra after anesthesia with isoflurane.

[0067] (4) Use scissors to cut open the mouse's abdominal cavity, take out the fetus, cut off the head and place it in a culture dish - use forceps to clamp the fetus' neck and use scissors to cut off the entire head. After the operation is completed, organize the mouse and fetus carcasses and put them in the freezer.

[0068] (5) Use straight forceps to clamp the eyes of the fetal mouse, use curved forceps to open the skull, remove the brain, and place it in a culture dish filled with buffer.

[0069] (6) Separate the left and right cerebral cortex along the central sulcus and discard the rest.

[0070] (7) Starting from the olfactory bulb, peel off the meninges of the separated left and right cerebral cortices.

[0071] (8) Prepare digestion solution: 0.25% trypsin: PBS = 1:1, a total of 5 ml, add DNase (20 μl / 5 ml), mix well and dispense into EP tubes, 500 μl per tube.

[0072] (9) Add two hemibrains to each tube and incubate in a 37°C water bath for 10 min, shaking up and down several times every 2 min.

[0073] (10) After digestion is complete, aspirate the digestion solution and add an appropriate amount of culture medium (trypsin: culture medium = 1:3) to terminate digestion.

[0074] (11) Aspirate the digestion medium and add about 800 μl of fresh medium (containing cytokines). Use a 1 ml pipette tip to slowly and evenly blow the brain tissue until the medium becomes uniform and turbid.

[0075] (12) Place the filter on a 50 ml centrifuge tube, aspirate the supernatant, taking care to avoid aspirating the precipitate, and then transfer it to the filter to collect the filtered cell suspension.

[0076] (13) Add 7 ml of culture medium (including cytokines) to each bacterial culture dish, collect the cell suspension and dispense it into the bacterial culture dish. (If using a 12-well plate, add 1.5 ml of culture medium to each well)

[0077] (14) Observe cell morphology under a microscope

[0078] The observation results showed that the cells were round.

[0079] (15) Clean up the workbench and dispose of discarded brain tissue.

[0080] Factors added to the culture medium: EGF: 80 μL / 40 ml;

[0081] BF-GF: 40 μL l / 40ml.

[0082] 2.2 Neural stem cell suspension transfection

[0083] The Linc-NSC interference recombinant vector and the control empty vector constructed in Example 1 were transfected into neural stem cells respectively, and the transfection steps were performed as follows:

[0084] 1) Determine the MOI value

[0085] ① Take the recombinant vector lentivirus out of the -80℃ refrigerator and slowly melt it on ice. Aspirate the original culture medium of the cells, add the virus stock solution to the cells according to different MOI values, MOI = 10, 50, 100, 200, 400, 800, 1000, add fresh culture medium to make up 50μL per well, and mix gently; 4h after lentiviral transfection, add 50μL of fresh culture medium to each well to make up to the culture volume;

[0086] ② 24 hours after lentiviral infection, remove the culture medium containing the virus and replace it with fresh complete culture medium and continue to culture in a 37℃ 5% CO2 incubator.

[0087] ③ 48 hours after lentiviral infection, fluorescence can be preliminarily observed under a microscope. Usually, 72 hours after infection, the infection efficiency is about 80%, and the MOI value corresponding to the group with good cell growth status is the optimal MOI value.

[0088] 2) Transfect cells

[0089] Procedure: 1 / 2 volume 4-hour infection method

[0090] One day before the experiment, 250uL of C57BL / 6 mouse neural stem cells (suspension cells) were plated in a 24-well plate and 5×10 5 -1 ×10 6 / ml, ready for transfection.

[0091] ① Before infection, take out the virus from the -80 degree refrigerator and quickly melt it in a 37 degree water bath. According to the selected MOI value (interference recombinant vector lentivirus MOI = 10), convert the corresponding virus stock solution volume (number of cells × MOI value / virus titer = virus volume), and add the virus stock solution to the cells according to the volume, mix well in an 8-shaped manner, and place in a 37 degree incubator.

[0092] ②After 4 hours of infection, remove the culture plate and add another 1 / 2 volume (250ul) of fresh culture medium.

[0093] ③ On the second day after infection (about 24 hours), remove the culture medium containing the virus, replace it with fresh complete culture medium, and continue to culture at 37°C. 48 hours after infection, for viruses with GFP reporter gene, the GFP expression efficiency can be observed by fluorescence microscopy.

[0094] ④ 72 hours after infection, the GFP fluorescence expression efficiency was detected by fluorescence microscopy. (There is no serum or antibiotics in the culture medium)

[0095] 3) Screening of stably transfected cell lines:

[0096] ① Initial screening of stable transfectants: If the viral vector carries puromycin resistance, replace the culture medium with fresh complete medium containing appropriate concentration of puromycin (1-3 μg / ml) 72 hours after infection. At the same time, prepare a group of ordinary cells as a blank control group (referred to as the Blank group, whose cell number and density are consistent with those of the virus-infected group cells), and add puromycin of the same final concentration. Replace the complete medium containing puromycin every 2-3 days until all cells in the Blank group are killed by puromycin.

[0097] ② Secondary screening and culture amplification of stable transfectants: Reduce the final concentration of puromycin by half (abbreviated as: 1 / 2 puro medium) to culture the surviving virus-infected group cells (including the target gene and control virus groups), and perform cell passaging when the cell density reaches about 80%. The cells after passaging are P2 stable transfectants. Continue to culture cells with 1 / 2 puro medium from P2 to P4 generations, expand the cells to the 4th generation, and freeze the P4 stable transfectant cell lines in large quantities for subsequent experiments.

[0098] ③Verify transfection efficiency: GFP fluorescence observation and qPCR.

[0099] The qPCR operation steps were carried out according to conventional methods. The nucleotide sequences of the forward primer and reverse primer of qPCR were as follows:

[0100] Forward primer: GGAAGTGAGGAGAGGGCTATT

[0101] Reverse primer: CATGATGTCTGTGTGTAGCTGA.

[0102] Reverse transcription was performed using HiScript® III All-in-one RT SuperMix (R333-01, Novagen) according to the kit instructions. Taq pro Universal SYBR qPCR Master Mix (Novagen) was used to determine the knockdown efficiency of Linc-NSC in the shRNA group and shRNA control group. qPCR reactions were run using the Bio-Rad Real-Time qPCR System. The 2-∆∆Cq method was used to measure the quantitative results of each sample.

[0103] Example 3 Animal model to verify the survival effect of NSC transplantation

[0104] 3.1 Stereotactic injection

[0105] C57BL / 6 mice (male, 6-8 weeks old) were randomly assigned to shRNA group (transfected with interference recombinant vector) and shRNA control group (transfected with empty vector), with 15 mice in each group. Animals were anesthetized with 1% sodium pentobarbital, and deep anesthesia was maintained with 2% isoflurane. Mice were fixed in a brain stereotaxic apparatus (RWD Life Science) and hair was removed. Povidone-iodine was used for disinfection, and sterile paper was laid. The injection site was located 1 5.5 mm lateral to the medial sagittal suture, 5.5 mm cephalad to the lambda suture, and 2.0 mm deep under the dura. Injections were performed with a 10 μL microsyringe at a rate of 0.5 μL / min; 5 μL of stable cell line suspension was injected in each group, with a total of 1×106 cells. The injection needle was kept in place for 10 minutes and then slowly removed. Finally, the scalp was sutured.

[0106] 3.2 Hematoxylin-eosin (HE) staining

[0107] The brain sections were removed from the refrigerator, rewarmed at room temperature, and then washed 3 times with 1x PBS for 5 minutes each. The sections were stained with hematoxylin staining solution and repeatedly observed under a microscope for 7-8 minutes during the staining process. The brain sections were then removed and rinsed with tap water for 20 minutes. The sections were then differentiated with differentiation solution for 30 seconds and rinsed with tap water for 15 minutes. The sections were then stained with eosin staining solution for 2-3 minutes and repeatedly observed under a microscope during the staining process. The brain sections were removed and rinsed with tap water for 5 minutes. The sections were then dehydrated and cleared in 95% ethanol (I), 95% ethanol (II), 100% ethanol (I), 100% ethanol (II), xylene (I), and xylene (II) in sequence for 1 minute and then sealed with neutral glue.

[0108] 3.3 Immunofluorescence microscopy

[0109] Tissue immunofluorescence staining was performed using a series of 10-µm-thick sections (Leica Instruments). Cells were cultured in complete medium containing 10% FBS and plated on slides coated with poly-D-lysine (PDL; Sigma-Aldrich, 5×). After 5 days, cells were fixed with 4% paraformaldehyde for 20 min at 4°C and then permeabilized with 0.1% (vol / vol) TritonX-100 for 10 min. Cells were then blocked with 1% BSA solution in phosphate-buffered saline (PBS). Sections and cell-climbing sections were incubated with the following primary antibodies: rat anti-nestin (1:200, Abcam, MA, USA), rabbit anti-NeuN (1:200, Abcam, MA, USA), rabbit anti-GFAP (1:300, CST, MA, USA), or goat anti-Olig2 (1:200, Abcam, MA, USA) antibodies overnight at 4°C. After washing with PBS, the sections were incubated with Alexa Fluor 555-conjugated chicken anti-goat IgG (1:1000; CST, MA, USA), Alexa Fluor 555-conjugated goat anti-rabbit IgG (1:1000; CST, MA, USA), and Alexa Fluor 488-conjugated goat anti-rat IgG (1:1000; CST, MA, USA). Finally, the coverslips were counterstained with 4',6-diamidino-2-phenylindole (DAPI, Beyotime) and imaged with a confocal microscope (Zeiss LSM800, Germany).

[0110] Example 4 Experiment on the influence of neural stem cell proliferation, apoptosis and differentiation

[0111] Cell proliferation was measured by direct counting. Cells were detached with Accutase (Sigma-Aldrich) for 5–10 min, fixed with 4% paraformaldehyde for 30 min at room temperature, and then permeabilized with 70% ethanol for at least 2 h at 4°C using a cell cycle and apoptosis analysis kit (Beyotime) and an apoptosis detection kit (BD Biosciences). The quadrants of the graphs represent live cells (AnV- / PI-;), early apoptosis (AnV+ / PI-;), or late apoptosis (AnV+ / PI+). Each sample was analyzed by flow cytometry using a Guava EasyCyte (Millipore) equipped with a 488 nm blue laser. Dead cells and debris were excluded by gating on forward scatter and pulse width distribution.

[0112] After establishing the cell culture, the cells are placed in suspension (SC) or adherent (differentiated cells) conditions to assess proliferation, respectively. The proliferation capacity of the cells is assessed by cell growth curves involving cell counting, and the results are shown in Table 1. Figure 1~Figure 4 As shown. Figure 1 The cell doubling time line graph of the shRNA group and the shRNA control group. Figure 1 It can be seen that the population doubling time of the shRNA group cells was less than 24 hours, and the population doubling time of the shRNA control group cells was about 72 hours, indicating that the doubling time of the shRNA group cells after transfection with shRNA (about 48 hours) was significantly reduced compared with the shRNA control group (about 72 hours). To investigate the effect of Linc-NSC knockdown on NSC stemness, we evaluated stemness gene expression and neurogenic properties in vitro under specific differentiation conditions. Specifically, we evaluated the expression of three pluripotency genes, Sox2, Oct4, and Nanog, and two neurogenicity-related genes, Map2 and S100b, to evaluate stemness maintenance and neurogenicity. Figure 2 As shown, Figure 2 This is a statistical diagram of the analysis of three pluripotency genes (Sox2, Oct4, and Nanog) and two neurogenic-related genes (Map2 and S100b) after knocking down linc-NSCs. Asterisks indicate that the difference between the control group and the shRNA group is significant. Figure 2It can be seen that the expression levels of the three genes Sox2, Map2 and S100b in the shRNA group and the shRNA control group showed statistically significant differences. The expression levels of the three genes Sox2, Map2 and S100b in the shRNA group were significantly lower than those in the shRNA control group. The stemness and differentiation of stem cells are two opposite directions. If the expression level of the biological index of stemness is high, it means that the cells maintain the state of stem cells at this time and do not tend to differentiate into other types of cells; if the expression level of the biological index of stemness is low, it means that the stemness of the cells is reduced, and there is a tendency to progress in the direction of differentiation, which has the effect of promoting differentiation. Therefore, these findings show that Linc-NSC significantly promotes the differentiation of NSC.

[0113] Further, Figure 3 The cell proliferation counts of the shRNA group and the shRNA control group were measured by flow cytometry. Figure 3 As shown, the shRNA group exhibited a significantly lower apoptosis rate compared with the shRNA control group (p<0.05), which may be partly attributed to the downregulation of Linc-NSC. Figure 4 The statistical data and images of neurospheres in adherent cultures immunostained with nestin and differentiation markers (GFAP, NeuN and Olig2) are to evaluate the three-lineage differentiation ability of cells, namely, the differentiation of neurons, astrocytes and oligodendrocytes. Among them, GFAP is a protein specifically expressed on astrocytes. GFAP+ indicates that glial fibrillary acid protein is positive. Labeling GFAP+ cells can confirm the differentiation of neural stem cells into astrocytes; NeuN is a protein that specifically marks mature neurons. NeuN+ indicates that neuron nucleus protein is positive. The presence of NeuN+ cells indicates that neural stem cells have successfully differentiated into neurons; Olig2 is an important marker for oligodendrocytes. Olig2+ indicates that oligodendrocyte-specific transcription factors are positive. Its positive cells indicate that cells have differentiated into the oligodendrocyte lineage.

[0114] Figure 4 Green, Nestin staining; purple, GFAP staining; red, NeuN staining; orange, Olig2 staining; blue, DAPI, scale bar = 20µm; Figure 4 Medium, n=5, Student t test, *p<0.05, **p<0.01, ***p<0.001. Figure 4 The results showed that the cells in the shRNA group and the shRNA control group showed the ability to undergo tri-lineage differentiation (GFAP+, NeuN+, and Olig2+) in vitro when cultured with 10% fetal bovine serum. However, the differentiation potential of the shRNA group was not as obvious as that of the shRNA control group. Figure 4Statistically significant differences were observed in .

[0115] Figure 5 Figure 1 is a graph showing the survival of NSC transplants after mice were transplanted into the shRNA group and the shRNA control group. Fifteen mice in each group were sacrificed at 2 and 4 weeks after transplantation to assess the survival and condition of the transplanted cells. All animals survived the study period of 4 weeks after transplantation. Four weeks after transplantation, the survival of transplanted NSCs was assessed by detecting GFP positivity under a 40x magnification objective.

[0116] Figure 5 B shows the general appearance of the transplanted mouse brain. Figure 5 C is the HE staining of the transplanted grafts at 2 weeks (×10, ×200) and 4 weeks (×10, ×200) after transplantation. Figure 5 B and Figure 5 As can be seen in C, within 2 weeks after transplantation, no gross tumor formation was observed in either the shRNA or shRNA control groups, and the transplanted cells survived in each group; Figure 5 E is the quantitative statistical graph of the number of surviving transplanted cells (n=5, Student t test, ****p<0.0001, no statistically significant difference, indicated by "ns"). Figure 5 E shows that within 4 weeks after transplantation, the number of GFP+NSCs in the shRNA group showed a statistically significant increase compared with the neural stem cells in the shRNA control group, while maintaining non-tumorigenicity, while in the shRNA control group, the number of GFP+NSCs did not show a significant increase, and the presence of transplanted cells was not observed in each animal. These findings suggest that knocking down Linc-NSC has the potential to prevent neural stem cell apoptosis and promote cell survival.

[0117] It will be easily understood by those skilled in the art that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. An application of long non-coding RNA in regulating the proliferation and differentiation of neural stem cells, characterized in that: The nucleotide sequence of the long non-coding RNA is shown in SEQ ID NO:

1.

2. The use according to claim 1, further comprising shRNA and an interference vector that interfere with the expression of the long non-coding RNA, wherein the shRNA comprises an interference sequence siRNA, and its nucleotide sequence is: GGGCCTCTATCAAGCCCATAA.

3. The use according to claim 2, wherein the sense sequence of the shRNA is: GATCCGGGCCTCTATCAAGCCCATAATTCAAGAGATTATGGGCTTGATAGAGGCCCTTTTTTG; The antisense sequence of the shRNA is: AATTCAAAAAAGGGCCTCTATCAAGCCCATAATCTCTTGAATTATGGGCTTGATAGAGGCCCG.

4. The use according to claim 2, wherein the interference vector is an adenovirus expression vector or a lentivirus expression vector.

5. The use according to claim 4, wherein the interference vector is pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO.

6. The use according to claim 5, wherein the shRNA sequence is inserted into the MCS downstream of the CMV promoter of the interference vector, and its restriction sites include BamHI, EcoRI, XhoI and XbaI.

7. A fluorescent quantitative PCR kit for detecting the long non-coding RNA according to claim 1, characterized in that: The kit includes: a forward primer, a reverse primer, and SYBR Green Master; wherein the nucleotide sequences of the forward primer and the reverse primer are as follows: Forward primer: GGAAGTGAGGAGAGGGCTATT Reverse primer: CATGATGTCTGTGTGTAGCTGA.

8. Use of the kit according to claim 7 in regulating the proliferation and differentiation of neural stem cells.

9. A method for regulating the proliferation and differentiation of neural stem cells for non-therapeutic purposes, characterized in that: The method comprises overexpressing the long non-coding RNA as claimed in claim 1 in neural stem cells, or knocking down the expression of the long non-coding RNA as claimed in claim 1 in neural stem cells.

Images