Application of rice chalkiness negative regulation gene CGR3

Abstract

The invention provides application of a rice chalkiness negative regulation gene CGR3, and belongs to the technical field of biology. According to the application, the rice chalkiness negative regulation gene CGR3 is used for regulating formation of rice chalkiness. According to the application of the rice chalkiness negative regulation gene CGR3 provided by the embodiment of the invention, the rice chalkiness negative regulation gene CGR3 is used for promoting the formation of rice chalkiness, that is, the chalkiness grain rate of rice is increased, and the effect is remarkable.

Description

Technical Field

[0001] The present disclosure relates to the field of biotechnology, and in particular to an application of a rice chalkiness negative regulatory gene CGR3. Background Art

[0002] As one of the three major food crops in the world, rice is the main food source for 4 billion people in the world. With the development of dwarfing breeding and hybrid rice breeding technology, rice yield has been greatly improved. However, the current rice yield after the increase still cannot meet the needs of the rapidly growing population. At the same time, due to economic development and improved living standards, people's consumption concepts have also changed, and the demand for high-quality rice is getting higher and higher. Therefore, under the premise of ensuring increased and stable rice production, improving rice quality has become a main direction of rice breeding.

[0003] Rice chalkiness is a white, opaque part formed by loose packaging of starch and protein bodies in the endosperm. As an undesirable trait, rice chalkiness has an adverse effect on the appearance quality, processing quality, and taste quality of rice. Since the formation of chalkiness is relatively complex and the mechanism of chalkiness has not been fully understood, the improvement efficiency of chalkiness is low, which is also a key problem encountered in the current high-quality rice breeding work.

[0004] Although some gene loci related to chalkiness have been located, only a few gene loci have been precisely located and cloned, which seriously limits the progress of research on the mechanism of chalkiness formation. If the molecular mechanism of chalkiness formation cannot be analyzed, it will be difficult to improve rice quality efficiently. Therefore, discovering new genes related to chalkiness formation and constructing mutants of related genes are of great significance for studying the mechanism of chalkiness formation and improving rice quality.

[0005] Public Content

[0006] In order to solve the problems of the prior art, the present disclosure provides an application of a rice chalkiness negative regulatory gene CGR3. The technical solution is as follows:

[0007] The present disclosure provides an application of a rice chalkiness negative regulatory gene CGR3, and the application comprises: using the rice chalkiness negative regulatory gene CGR3 to promote the formation of rice chalkiness.

[0008] Specifically, the application includes: knocking out, replacing or changing the amino acid sequence of the rice chalkiness negative regulatory gene CGR3 protein to increase the chalkiness rate of rice.

[0009] Specifically, the application includes: selecting CGR3-T as a target for gene knockout in the sequence of the rice chalkiness negative regulatory gene CGR3, wherein the sequence of CGR3-T is shown in SEQ ID NO: 1 in the sequence table;

[0010] A CGR3 gene knockout vector is constructed according to the CGR3-T using a first forward primer, a first reverse primer, a second forward primer and a second reverse primer, wherein the sequence of the first forward primer is shown in SEQ ID NO: 2 in the sequence list, the sequence of the first reverse primer is shown in SEQ ID NO: 3 in the sequence list, the sequence of the second forward primer is shown in SEQ ID NO: 4 in the sequence list, and the sequence of the second reverse primer is shown in SEQ ID NO: 5 in the sequence list;

[0011] The CGR3 gene knockout vector is transformed into a receptor material to obtain a homozygous knockout mutant with a high chalky grain rate.

[0012] Further, the application includes: using the pYLsgRNA-OsU6a plasmid as a template, using the first forward primer and the first reverse primer to amplify the promoter U6a by a first PCR to obtain a first amplification product of the U6b promoter containing the CGR3-T, and using the second forward primer and the second reverse primer to amplify the guide fragment sgRNA by a second PCR to obtain a second amplification product of the guide sgRNA fragment containing the CGR3-T;

[0013] Purifying and recovering the first amplification product and the second amplification product to obtain purified first amplification product and second amplification product;

[0014] Connecting the purified first amplification product and the purified second amplification product by overlapping PCR to obtain a connection product;

[0015] The ligation product is connected to the pYLCRISPR / Cas9Pubi-H vector to obtain the CGR3 gene knockout vector.

[0016] Furthermore, every 50 μL of the first PCR amplification reaction system includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the first forward primer with a concentration of 10 μM; 4 μL of the first reverse primer with a concentration of 10 μM; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase with a concentration of 5 U / μL; and 31.75 μL of ddH2O.

[0017] Furthermore, every 50 μL of the second PCR amplification reaction system includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the second forward primer with a concentration of 10 μM; 4 μL of the second reverse primer with a concentration of 10 μM; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase with a concentration of 5 U / μL; and 31.75 μL of ddH2O.

[0018] Furthermore, each 15 μL of the ligated reaction system includes: 10×CutSmart Buffer 1.5 μL; 10 mM ATP mixture 1.5 μL; 100 ng / μL pYLCRISPR / Cas9Pubi-H vector 0.5 μL; 100 ng / μL sgRNA expression cassette fragment 1 μL; 20 U / μL BsaI-HF endonuclease 0.5 μL; 400 U / μL T4 DNA ligase 0.2 μL; ddH2O 9.8 μL.

[0019] The beneficial effect brought about by the technical solution provided by the embodiment of the present disclosure is: the embodiment of the present invention provides an application of the rice chalkiness negative regulatory gene CGR3, and the rice chalkiness negative regulatory gene CGR3 is used to increase the formation of rice chalkiness, that is, to increase the chalkiness rate of rice, and the effect is significant. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0021] Figure 1a This is a photograph of the seeds of the control group Nip provided in the embodiments of the present disclosure after being ground into polished rice;

[0022] Figure 1b This is a photograph of the seeds of the CGR3-KO-5 group provided in the embodiments of the present disclosure after being ground into polished rice;

[0023] Figure 1c This is a photograph of the seeds of the CGR3-KO-6 group provided in the embodiments of the present disclosure after being ground into polished rice;

[0024] Figure 2 It is a statistical graph of the proportion of chalky seeds to the total number of seeds in the control group Nip, the CGR3-KO-5 group and the CGR3-KO-6 group provided in the embodiments of the present disclosure;

[0025] Figure 3aIt is the internal structure of the seeds of the control group Nip provided in the embodiments of the present disclosure;

[0026] Figure 3b is the internal structure of the seeds of the CGR3-KO-5 group provided in the embodiments of the present disclosure;

[0027] Figure 3c is the internal structure of the seeds of the CGR3-KO-6 group provided in the embodiments of the present disclosure;

[0028] Figure 4a This is a diagram of the structure of seed endosperm starch granules of the control group Nip provided in the embodiments of the present disclosure;

[0029] Figure 4b This is a diagram of the structure of seed endosperm starch granules of the CGR3-KO-5 group provided in the embodiments of the present disclosure;

[0030] Figure 4c This is a diagram of the structure of seed endosperm starch granules of the CGR3-KO-6 group provided in the embodiments of the present disclosure. DETAILED DESCRIPTION

[0031] In order to make the objectives, technical solutions and advantages of the present disclosure more clear, the embodiments of the present disclosure will be further described in detail below with reference to the accompanying drawings.

[0032] Example

[0033] The present disclosure provides an application of a rice chalkiness negative regulatory gene CGR3, and the application includes: using the rice chalkiness negative regulatory gene CGR3 to promote the formation of rice chalkiness.

[0034] Specifically, the application includes: knocking out, replacing or changing the amino acid sequence of the rice chalkiness negative regulatory gene CGR3 (LOC_Os11g31620) protein to increase the chalkiness rate of rice.

[0035] In this example, the sequence of rice chalkiness negative regulatory gene CGR3 can be obtained on the Rice Genome Annotation Project (uga.edu) website, and the coding sequence is shown as SEQ ID NO: 6 in the sequence listing.

[0036] Specifically, the application includes: selecting CGR3-T as a gene knockout target in the sequence of rice chalkiness negative regulatory gene CGR3, the sequence of CGR3-T is shown in SEQ ID NO: 1 in the sequence table, specifically: TGACAACCATCCGCTTCAGCCGG; in this embodiment, on the gene knockout target selection website of Huazhong Agricultural University (http: / / crispr.hzau.edu.cn / CRISPR2 / ), according to the obtained CGR3 coding sequence, the CGR3 gene knockout target was designed using the CRISPR-P2.0 tool to obtain CGR3-T.

[0037] The CGR3 gene knockout vector was constructed based on CGR3-T;

[0038] The CGR3 gene knockout vector was transformed into the recipient material to obtain a homozygous knockout mutant with a high chalky grain rate.

[0039] Furthermore, the application includes: using the pYLsgRNA-OsU6a plasmid (donated by the team of Academician Liu Yaoguang, prepared using existing technology) as a template, using the first forward primer and the first reverse primer to amplify the promoter U6a by a first PCR to obtain a first amplification product of the U6b promoter containing CGR3-T, using the second forward primer and the second reverse primer to amplify the U6b promoter fragment containing the CGR3-T sequence and the guide sgRNA fragment containing the CGR3-T sequence by a second PCR to obtain a second amplification product of the guide sgRNA fragment containing CGR3-T, the sequence of the first forward primer (UF) is as shown in SEQ ID NO: 2 in the sequence list, specifically: CTCCGTTTTACCTGTGGAATCG, the first reverse primer (CGR 3-U6aT) is as shown in SEQ ID NO: 3 in the sequence list, specifically: GCTGAAGCGGATGGTT GTCACGGCAGCCAAGCCAGCA, and the sequence of the second forward primer (CGR3-gT) is as shown in SEQ ID NO: 4 in the sequence list. NO:4, specifically: TGACAACCATCCGCTTCAGCGTTTTAGAGCTAGAAAT, the second reverse primer (gR-R) is shown in SEQ ID NO:5 in the sequence listing, specifically: CGGAGGAAAATTCCATCCAC.

[0040] Purifying and recovering the first amplification product and the second amplification product to obtain a purified first amplification product and a purified second amplification product;

[0041] The U6b promoter fragment containing the CGR3-T sequence and the guide sgRNA fragment containing the CGR3-T sequence were connected by overlapping PCR to obtain a connection product;

[0042] The ligation product was connected to the pYLCRISPR / Cas9Pubi-H vector to obtain the CGR3 gene knockout vector.

[0043] Furthermore, each 50 μL of the first PCR amplification reaction system includes: 10×Pfu Buffer (with Mg 2+ )5μL; dNTP (2.5mM each) 4μL; first forward primer with a concentration of 10μM 4μL; first reverse primer with a concentration of 10μM 4μL; template DNA 1μL; Pfu DNA high-fidelity polymerase with a concentration of 5U / μL 0.25μL; ddH2O 31.75μL, total volume 50μL.

[0044] Further, the first PCR amplification procedure is:

[0045]

[0046] Furthermore, each 50 μL of the second PCR amplification reaction system includes: 10×Pfu Buffer (with Mg 2+ )5μL; dNTP (2.5mM each) 4μL; second forward primer with a concentration of 10μM 4μL; second reverse primer with a concentration of 10μM 4μL; template DNA 1μL; Pfu DNA high-fidelity polymerase with a concentration of 5U / μL 0.25μL; ddH2O 31.75μL, total volume 50μL.

[0047] Further, the second PCR amplification procedure is:

[0048]

[0049] Furthermore, each 50 μL of the recombinant amplification reaction system includes: 10×Pfu Buffer (withMg 2+ )5μL; dNTP (2.5mM each) 4μL; first forward primer (UF) with a concentration of 10μM 4μL; second reverse primer (gR-R) with a concentration of 10μM 4μL, promoter U6a 50ng, guide fragment sgRNA 50ng; Pfu DNA high-fidelity polymerase with a concentration of 5U / μL 0.25μL; supplement ddH2O to a total volume of 50μL.

[0050] Further, the overlapping PCR amplification procedure is:

[0051]

[0052] After the overlapping PCR amplification reaction was completed, the amplification product was recovered using a 1% agarose gel. The target amplification product was about 700 bp in length, which was the sgRNA expression cassette. The sgRNA expression cassette was then connected to the pYLCRISPR / Cas9Pubi-H vector using the Golden Gate ligation method.

[0053] The ligation reaction system includes: 1.5μL 10×CutSmart Buffer; 1.5uL 10mM ATP mixture; 0.5μL 100ng / μL pYLCRISPR / Cas9Pubi-H vector; 1μL 100ng / μL sgRNA expression cassette fragment; 0.5μL 20U / μL BsaI-HF endonuclease; 0.2μL 400U / μL T4 DNA ligase; 9.8μL ddH2O.

[0054] The reaction procedure for the connection is:

[0055]

[0056] After the ligation reaction is completed, a ligation product is obtained. After the ligation product is sequenced to verify that the sequence is correct, the construction of the CGR3 gene knockout vector is completed.

[0057] The CGR3 gene knockout vector was transformed into Agrobacterium EHa105 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) by electroporation. Then, the CGR3 gene knockout vector was transformed into the receptor material Nipponbare (commercially available) by Agrobacterium infection. The specific steps are as follows:

[0058] 1. Induction of callus tissue:

[0059] The husks of mature Nipponbare seeds were removed using a small rice huller, and then the shelled and broken seeds were removed manually, and the plump seeds were retained. 16 g of shelled seeds were weighed and placed in a 50 mL centrifuge tube.

[0060] First, rinse it upside down with tap water for 5 times, then wash it upside down with distilled water for 4 times, then treat it with 70% ethanol on a flip shaker for 5 minutes, then wash it upside down with sterile water for 3 times, and finally add 1% sodium hypochlorite (NaClO) solution and sterilize it on a horizontal shaker at 100rpm for 15-20 minutes. During the disinfection period, prepare the sterilized filter paper, spoon, tweezers and alcohol lamp on the clean bench. The spoon and tweezers should be burned on the alcohol lamp for a few minutes in advance, and then sterilely cooled to room temperature for use.

[0061] After the seeds are disinfected, open the centrifuge tube on the clean bench, pour out the sodium hypochlorite solution, wash the seeds with sterile water 4 to 5 times on the clean bench to remove the residual sodium hypochlorite solution, then use a spoon to spread the seeds evenly on the sterilized filter paper and place them on the clean bench for 1 to 2 hours until the seeds are dry.

[0062] Use tweezers to transfer the dried seeds to N6 solid induction medium, seal the culture dish with sealing film, and culture at 28°C in the dark for about 30 days to obtain freshly induced callus.

[0063] 2. Subgeneration:

[0064] The callus tissue in good condition is generally light yellow and dense. Observe the induced callus tissue, transfer the callus tissue in relatively good condition to a new N6 solid culture medium, and culture it at a constant temperature of 28°C in the dark for about two weeks to complete the subculture of the callus tissue.

[0065] 3. Cultivation and suspension of Agrobacterium:

[0066] The electro-transformed Agrobacterium EHa105 containing the CGR3 gene knockout vector was spread on a YEB solid medium containing rifampicin and kanamycin, and cultured overnight in a 28°C incubator in the dark.

[0067] Add 10 mL of 1 / 2N6 liquid medium (containing 150 μM AS) to a 50 mL centrifuge tube, transfer the Agrobacterium cells containing the CGR3 gene knockout vector grown on the YEB solid medium to the 1 / 2N6 liquid medium, and mix well to obtain an Agrobacterium suspension. Use the same 1 / 2N6 liquid medium to adjust the bacterial concentration to about OD600 = 0.8.

[0068] 4. Infection:

[0069] Transfer the subcultured fresh callus to the above Agrobacterium suspension and co-cultivate on a low-speed shaker for 15 to 20 minutes. Then carefully pour out the Agrobacterium suspension, transfer the callus to sterile filter paper and dry it on a clean bench for 1 to 2 hours. Finally, transfer the dried callus to 1 / 2N6 solid culture medium (containing 150μMAS), and culture it in a 20℃ incubator in the dark for 1 to 2 days to obtain Agrobacterium-infected callus.

[0070] 5. Removal of Agrobacterium

[0071] Transfer the infected callus to a sterile 250 mL conical flask, add 150 mL of sterile water, shake gently to wash the callus, pour out the sterile water, and repeat the washing several times until the liquid is clear.

[0072] The cleaned callus tissue was transferred to N6 liquid culture medium containing 500 mg / L cephalosporin, sterilized on a low-speed shaker for 15 to 20 minutes, and then the culture medium was carefully poured out on a clean bench. This step was repeated 3 times.

[0073] After sterilization, the callus tissue was transferred to sterile filter paper and placed on a clean bench until completely dry.

[0074] 6. Screening of callus tissue

[0075] The sterilized and dried callus tissue was transferred to N6 solid medium (added with a final concentration of 250 mg / L cephalosporin and 50 mg / L hygromycin), cultured in a 28°C incubator in the dark for 30 days, and the callus tissue was screened.

[0076] 7. Differentiation

[0077] Observe the callus tissue growing on N6 solid medium, select callus with better growth, transfer to MS solid medium, and culture in a 28℃ incubator in the dark for 10 days. Then transfer to light culture for about 20 days.

[0078] 8. Rooting

[0079] When the callus grows green shoots of about 1 to 2 cm in length, it is transferred to 1 / 2MS rooting medium and cultured in a 28°C incubator under constant temperature and light for about 15 days until the seedlings grow roots.

[0080] 9. Hardening and transplanting

[0081] Take the seedlings with roots out from the 1 / 2MS medium, wash the medium off the roots gently with tap water, put the seedlings in a test tube filled with sterilized water, change the water every day, and after about 7 days, remove the dead roots, keep the main roots and healthy lateral roots, and transplant them into the soil. At this time, the seedlings are T0 generation plants, and after two generations of self-pollination, T2 generation strains can be obtained for subsequent experiments.

[0082] The phenotype of the CGR3 homozygous knockout mutant was observed. Specifically, in this example, two CGR3 homozygous knockout mutants were selected, namely CGR3-KO-5 group and CGR3-KO-6 group. Meanwhile, the receptor material Nipponbare was used as the control group Nip.

[0083] The seeds of the control group, CGR3-KO-5 group and CGR3-KO-6 group were soaked, germinated, sown and raised as normal. When the seedlings were 27 days old, they were transplanted to the field and planted with a plant spacing of 16.7 cm and a row spacing of 26.7 cm. Each group was planted with 30 plants and carried out normal field management.

[0084] When the seeds are ripe, use a small rice husk machine to remove the seed husks, grind them into fine rice, and take pictures. Figure 1a , Figure 1b and Figure 1c As shown. Figure 1a , Figure 1b and Figure 1c It can be seen that the number of chalky seeds in the CGR3-KO-5 and CGR3-KO-6 groups was significantly higher than that in the control group Nip. At the same time, the proportion of chalky seeds in the control group Nip and the CGR3-KO-5 and CGR3-KO-6 groups to the total number of seeds, i.e., the chalky seed rate, was also counted. 50 seeds were counted in each group, and 5 biological replicates were performed. The results are shown in Figure 2 As shown. Figure 2 It can be seen that the chalky particle rate of the control group Nip was significantly lower than that of the CGR3-KO-5 group and the CGR3-KO-6 group.

[0085] The seeds of the control group Nip and the CGR3-KO-5 and CGR3-KO-6 groups were sliced ​​into 2 mm thick sections and the internal structure of the seeds was observed under a stereo microscope. Figure 3a , Figure 3b and Figure 3c As shown. Figure 3a , Figure 3b and Figure 3c It can be seen that there are large white opaque areas inside the seeds of the CGR3-KO-5 and CGR3-KO-6 groups, while there are no opaque areas inside the seeds of the control group Nip.

[0086] At the same time, 2 mm thick slices made from seeds of the control group Nip and the CGR3-KO-5 and CGR3-KO-6 groups were glued to the sample stage with conductive glue, and gold was sprayed in an ion sputtering coater (Quorum SC7620). The structure of seed endosperm starch granules was observed under a scanning electron microscope (ZEISS GeminiSEM 300). Figure 4a , Figure 4b and Figure 4c As shown. Figure 4a , Figure 4b and Figure 4c It can be seen that the starch granules in the endosperm of the control group Nip are regular and tightly arranged, with no gaps between the starch granules, while the starch granules in the seed endosperm of the CGR3-KO-5 and CGR3-KO-6 groups are irregular and loosely arranged, with large gaps between the starch granules.

[0087] In summary, the chalky particle rates in the CGR3-KO-5 and CGR3-KO-6 groups were significantly higher than that in the control group Nip.

[0088] The above description is only an optional embodiment of the present disclosure and is not intended to limit the present disclosure. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present disclosure shall be included in the protection scope of the present disclosure.

Claims

1. An application of a rice chalkiness negative regulatory gene CGR3, characterized in that: The application comprises: using the rice chalkiness negative regulatory gene CGR3 to promote the formation of rice chalkiness.

2. The use according to claim 1, characterized in that: The application includes: knocking out, replacing or changing the amino acid sequence of the rice chalkiness negative regulatory gene CGR3 to increase the chalkiness rate of rice.

3. The use according to claim 1, characterized in that: The applications include: Selecting CGR3-T as a target for gene knockout in the sequence of the rice chalkiness negative regulatory gene CGR3, the sequence of CGR3-T is shown in SEQ ID NO: 1 in the sequence table; A CGR3 gene knockout vector is constructed according to the CGR3-T using a first forward primer, a first reverse primer, a second forward primer and a second reverse primer, wherein the sequence of the first forward primer is shown in SEQ ID NO: 2 in the sequence list, the sequence of the first reverse primer is shown in SEQ ID NO: 3 in the sequence list, the sequence of the second forward primer is shown in SEQ ID NO: 4 in the sequence list, and the sequence of the second reverse primer is shown in SEQ ID NO: 5 in the sequence list; The CGR3 gene knockout vector is transformed into a receptor material to obtain a homozygous knockout mutant with a high chalky grain rate.

4. The use according to claim 3, characterized in that: The application includes: using the pYLsgRNA-OsU6a plasmid as a template, using the first forward primer and the first reverse primer to amplify the promoter U6a through a first PCR to obtain a first amplification product of the U6b promoter containing the CGR3-T, and using the second forward primer and the second reverse primer to amplify the guide fragment sgRNA through a second PCR to obtain a second amplification product containing the guide sgRNA fragment of the CGR3-T; Purifying and recovering the first amplification product and the second amplification product to obtain purified first amplification product and purified second amplification product; Connecting the purified first amplification product and the purified second amplification product by overlapping PCR to obtain a connection product; The ligation product is connected to the pYLCRISPR / Cas9Pubi-H vector to obtain the CGR3 gene knockout vector.

5. The use according to claim 4, characterized in that: The reaction system of the first PCR amplification per 50 μL includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the first forward primer with a concentration of 10 μM; 4 μL of the first reverse primer with a concentration of 10 μM; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase with a concentration of 5 U / μL; and 1.75 μL of ddH2O3.

6. The use according to claim 4, characterized in that: Every 50 μL of the second PCR amplification reaction system includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the second forward primer with a concentration of 10 μM; 4 μL of the second reverse primer with a concentration of 10 μM; 1 μL of template DNA; 0.25 μL of Pfu DNA high-fidelity polymerase with a concentration of 5 U / μL; and 1.75 μL of ddH2O3.

7. The use according to claim 4, characterized in that: The reaction system of the recombination amplification per 50 μL includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the first forward primer with a concentration of 10 μM; 4 μL of the second reverse primer with a concentration of 10 μM, 50 ng of the promoter U6a, 50 ng of the guide fragment sgRNA; 0.25 μL of PfuDNA high-fidelity polymerase with a concentration of 5 U / μL; and ddH2O is supplemented to a total volume of 50 μL.

8. The use according to claim 4, characterized in that: Each 15 μL of the ligation reaction system includes: 10×CutSmart Buffer 1.5 μL; 10 mM ATP mixture 1.5 μL; 100 ng / μL pYLCRISPR / Cas9Pubi-H vector 0.5 μL; 100 ng / μL sgRNA expression cassette fragment 1 μL; 20 U / μL BsaI-HF endonuclease 0.5 μL; 400 U / μL T4 DNA ligase 0.2 μL; ddH2O 9.8 μL.

Images