Marker of target IRBIT for regulating and controlling gastric cancer Ca < 2 + > signal for gastric cancer diagnosis or prognosis evaluation and application of marker

Abstract

The invention discloses a marker for regulating a gastric cancer Ca < 2 + > signal target IRBIT for gastric cancer diagnosis or prognosis evaluation and application of the marker, and relates to the technical field of biological medicines. The invention relates to a novel application of a reagent for detecting IRBIT protein or a coding gene thereof in preparation of a product for gastric cancer diagnosis or prognosis evaluation. Experiments prove that IRBIT is highly expressed in gastric cancer tissues and is in positive correlation with tumor size, clinical staging and metastasis; in addition, IRBIT may cause abnormal Ca < 2 + > signals in gastric cancer to promote proliferation, migration and invasion of gastric cancer cells. Therefore, IRBIT is expected to become a marker for gastric cancer diagnosis or gastric cancer prognosis evaluation clinically; meanwhile, IRBIT may become a new target in clinical treatment of gastric cancer by regulating and controlling the gastric cancer Ca < 2 + > signal, which may provide a new treatment strategy and theoretical basis for prevention and treatment of gastric cancer, has important scientific significance and clinical value, and may fill the blank in the research field of regulating and controlling the gastric cancer Ca < 2 + > signal.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a method for regulating gastric cancer Ca 2+ Signal target IRBIT marker for gastric cancer diagnosis or prognosis evaluation and application thereof. Background Art

[0002] Gastric cancer is one of the most common malignant tumors in my country. Its etiology is complex, and the molecular mechanisms involved in its occurrence and development have not yet been fully elucidated, which makes it difficult to effectively prevent and treat gastric cancer. The treatment methods for gastric cancer mainly include: surgical treatment, chemotherapy, targeted therapy, immunotherapy, radiotherapy, traditional Chinese medicine treatment, etc.

[0003] At present, the survival of gastric cancer patients is closely related to the stage at diagnosis. Due to the lack of specific symptoms and early diagnostic methods in gastric cancer patients in the early stage, most patients have already developed distant metastasis at the time of diagnosis, resulting in unsatisfactory expectations and survival after treatment.

[0004] Therefore, it is necessary to find new tumor diagnostic markers that may be used in the diagnosis of gastric cancer, so as to facilitate the timely detection of gastric cancer patients in the early stages and early therapeutic intervention, and also to provide new targets and research directions for the treatment of gastric cancer.

[0005] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention and should not be regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the invention

[0006] In view of the above technical problems, the embodiment of the present invention provides a method for regulating gastric cancer Ca 2+ The target IRBIT signal is used as a marker for gastric cancer diagnosis or prognosis evaluation and its application to solve the problems raised in the above background technology.

[0007] A reagent for detecting IRBIT protein or its encoding gene is used in the preparation of a product for gastric cancer diagnosis or prognosis assessment.

[0008] Preferably, the IRBIT protein or the gene encoding it is used as a marker for gastric cancer diagnosis or gastric cancer prognosis assessment.

[0009] Preferably, the expression of IRBIT protein is upregulated in gastric cancer patients.

[0010] Preferably, the expression level of IRBIT protein in gastric cancer tissue of gastric cancer patients is positively correlated with tumor size, clinical stage and metastasis.

[0011] Preferably, the product for gastric cancer diagnosis or prognosis assessment includes primers and probes for identifying the gene encoding the IRBIT protein, and antibodies for recognizing the IRBIT protein.

[0012] Preferably, the primers for identifying the IRBIT protein encoding gene include: a front primer sequence as shown in SEQ ID NO.1, and a rear primer sequence as shown in SEQ ID NO.2; specifically, the sequence of SEQ ID NO.1 is: TCGCTCGATCTCACAGTCCT; the sequence of SEQ ID NO.2 is: TCCCGGCGTCCAAATTCTG.

[0013] A biomarker for gastric cancer diagnosis or prognosis assessment, comprising IRBIT protein or a gene encoding the same.

[0014] A kit for gastric cancer diagnosis or prognosis assessment, the kit is used to detect IRBIT protein or its encoding gene.

[0015] Preferably, the primers for identifying the IRBIT protein encoding gene include: a front primer sequence as shown in SEQ ID NO.1, and a rear primer sequence as shown in SEQ ID NO.2.

[0016] Preferably, the kit comprises primers and probes for recognizing the gene encoding the IRBIT protein, and antibodies for recognizing the IRBIT protein.

[0017] A use of a preparation for inhibiting the expression of IRBIT protein or its encoding gene in the preparation of a drug for treating gastric cancer.

[0018] A method for regulating gastric cancer Ca 2+ The target IRBIT of the signal is used as a marker for gastric cancer diagnosis or prognosis evaluation and its application, and has the following beneficial effects: 1. The present invention has experimentally confirmed that IRBIT is highly expressed in gastric cancer tissue and is positively correlated with tumor size, clinical stage and metastasis; and IRBIT may cause abnormal Ca in gastric cancer. 2+ Signals promote the proliferation, migration and invasion of gastric cancer cells. Therefore, IRBIT is expected to become a marker for gastric cancer diagnosis or gastric cancer prognosis assessment in clinical practice; 2. IRBIT may regulate Ca2+ in gastric cancer 2+ signal, becoming a new target in the clinical treatment of gastric cancer, which may provide new treatment strategies and theoretical basis for the prevention and treatment of gastric cancer, has important scientific significance and clinical value, and may fill the gap in regulating gastric cancer Ca 2+ Gaps in the field of signal research. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Result diagrams of various experiments in Example 1 of the present invention; in, Figure 1 A- Figure 1 B is the immunohistochemical detection result of IRBIT in human gastric cancer tissue; Figure 1 C-Figure shows the RT-qPCR detection results of IRBIT in human gastric cancer cell lines; Figure 1 D- Figure 1 E is the Western-blot detection result of IRBIT in human gastric cancer cell line; Figure 1 F- Figure 1 H is the analysis result of IRBIT expression level and clinical pathological characteristics; Figure 2 The results of constructing IRBIT overexpression and knockdown cell lines in human gastric cancer cell lines in Example 2 of the present invention; in, Figure 2 A- Figure 2 B is the Western-blot verification result of IRBIT overexpression and knockdown cell lines; Figure 2 C- Figure 2 D is the RT-qPCR validation results of IRBIT overexpression and knockdown cell lines; Figure 3 This is a result diagram of the CCK-8 experiment in Example 2 of the present invention; in, Figure 3 A- Figure 3 B shows the cell proliferation results at 24 h and 48 h after IRBIT overexpression in gastric cancer cell MGC803; Figure 3 C- Figure 3 D is the cell proliferation results 24 h and 48 h after IRBIT knockdown in gastric cancer cell BGC823; Figure 4 This is a result diagram of the cell clone formation experiment in Example 2 of the present invention; in, Figure 4 A- Figure 4 B is the result of cell cloning after IRBIT overexpression in gastric cancer cell MGC803; Figure 4 C- Figure 4 D is the result of cell cloning after IRBIT knockdown in gastric cancer cell BGC823; Figure 5 This is a result diagram of the nude mouse tumor formation experiment in Example 2 of the present invention; Figure 5 A- Figure 5B shows the changes in tumor volume in nude mice after IRBIT was overexpressed in gastric cancer cells MGC803; Figure 5 C- Figure 5 D shows the changes in tumor volume in nude mice after IRBIT knockdown in gastric cancer cell BGC823; Figure 6 Result diagrams of each experiment in Example 3 of the present invention; Figure 6 A is the result of single-cell calcium imaging experiment using Fura-2 and AM after normal gastric mucosal cells GES-1 were given IP3 receptor agonist IP3 hexapotassium salt; Figure 6 B shows the chelation of ER Ca by TPEN in GES-1 cells. 2+ After that, single-cell calcium imaging was performed using Fura-2 AM after IP3 hexapotassium salt was administered; Figure 6 C is the use of ER calcium chelator TPEN to chelate ER Ca in gastric cancer cells BGC823 2+ After that, single-cell calcium imaging was performed using Fura-2 AM after IP3 hexapotassium salt was administered; Figure 6 D is the gastric cancer cell BGC823 control group, which uses the endoplasmic reticulum calcium chelator TPEN to chelate endoplasmic reticulum Ca 2+ After that, single-cell calcium imaging was performed using Fura-2 AM after IP3 hexapotassium salt was administered; Figure 6 E: After knocking down IRBIT of BGC823 in gastric cancer cells, ER calcium chelator TPEN was used to chelate ER Ca 2+ After IP3 hexapotassium salt was administered, single-cell calcium imaging was performed using Fura-2 AM. Figure 6 F is the statistical graph of 6D and 6E; Figure 6 G is the Western-blot experimental verification result of knocking down IRBIT in gastric cancer cell BGC823. DETAILED DESCRIPTION

[0020] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0021] In view of the above technical problems, the embodiment of the present invention provides a method for regulating gastric cancer Ca2+ The target IRBIT signal is used as a marker for gastric cancer diagnosis or prognosis evaluation and its application to solve the problems raised in the above background technology.

[0022] Embodiment 1 1. Experimental materials: RNAeasy Animal RNA Extraction Kit (spin column type) was purchased from Shanghai Biotech Co., Ltd., China (Cat. No. R0027); BeyoRT™ II cDNA First-Strand Synthesis Kit (RNase H-) was purchased from Shanghai Biotech Co., Ltd., China (Cat. No. D7168L); PAGE Gel Rapid Preparation Kit (10%) was purchased from Shanghai Yazyme Biotechnology Co., Ltd., China (Cat. No. PG112); Three-color prestained protein marker (10 kDa-250 kDa) was purchased from Shanghai Yazyme Biotechnology Co., Ltd., China (Cat. No. WJ103); skim milk powder was purchased from Shanghai Yazyme Biotechnology Co., Ltd., China (Cat. No. PS112L); RIPA lysis buffer (strong) was purchased from MCE (Cat. No. HY-K1001); protease inhibitor cocktail (EDTA-Free, 100x in DMSO) was purchased from MCE (Cat. No. HY-K0010); phosphatase inhibitor cocktail I (100x in DMSO) was purchased from MCE (catalog number: HY-K0021); rapid transfer buffer (20x) was purchased from Suzhou Xinsaimei Biotechnology Co., Ltd., China (catalog number: WB4600); universal antibody diluent was purchased from Suzhou Xinsaimei Biotechnology Co., Ltd., China (catalog number: WB500D); 20xTBST buffer was purchased from Beijing Solebold Technology Co., Ltd., China (catalog number: T1082); 5xSWE fast high-resolution electrophoresis buffer was purchased from Wuhan Saiweier Biotechnology Co., Ltd., China (catalog number: G2152-1L); primary antibody was purchased from Invitrogen, USA (catalog number: PA5-60038); secondary antibody was purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., China (catalog number: ZB-2301); phosphate buffered saline (PBS) was purchased from Qidu Pharmaceutical Biotechnology Co., Ltd. (catalog number: QB1002); RPMI1640 medium was purchased from Thermo Fisher Scientific, USA (catalog number: C11875500BT).

[0023] 2. The experimental reagents are prepared as follows: (1) Preparation of RIPA lysis buffer: RIPA lysis buffer: PMSF: protease inhibitor: phosphorylase inhibitor = 100: 1: 1: 1 was prepared according to the volume ratio. It was prepared immediately before use and the whole process was performed on ice. (2) Preparation of 1xTBST buffer: Add 100 mL of 20xTBST buffer to 1900 mL of ultrapure water and 1 mL of Tween 20; (3) Cell culture medium: by volume, the culture medium contains 90% basal culture fluid, 10% fetal bovine serum, and 1% streptomycin / penicillin; 3. Cell experiment methods: (1) Cell recovery: Quickly remove the frozen GES-1, AGS, SGC7901, BGC823, MGC803, and MKN45 cells from liquid nitrogen and place them in an ice box. Then quickly put the cryotube into a water bath that has been preheated to 37°C to thaw quickly, and immediately take it into the clean bench. Pipette the cell freezing solution into the centrifuge tube that has been placed in the culture medium, and pipette up and down to mix the freezing solution and complete culture medium thoroughly. Centrifuge at 800 rpm for 5 min at room temperature. After centrifugation, aspirate and discard the supernatant, add 5 mL of culture medium to the cell pellet in the centrifuge tube, repeatedly pipette to make a cell suspension, put it into a culture bottle, and culture it in a cell culture incubator at 37°C and 5% CO2.

[0024] (2) Cell counting and plating: Take the above six types of cells in the logarithmic growth phase, digest with trypsin, collect the cells, add RPMI1640 complete medium, and mix by pipetting to prepare cell suspension. After counting with an ELISA reader, adjust the above cell seeding density to 1x10 6 Each cell type was inoculated into two 60 mm dishes, with about 200 μL per well, and cultured in a constant temperature incubator at 37°C and 5% CO2.

[0025] (3) Extraction of RNA and protein: When the cell growth density in the dish reaches 70% to 80% confluence, RNA and protein of the above six cells can be extracted. After RNA is reverse transcribed into cDNA using the Bio-Tec reverse transcription kit, the mRNA expression of IRBIT in each cell is detected by RT-qPCR, where the primer sequence of IRBIT is: IRBIT (F: TCGCTCGATCTCACAGTCCT, R: TCCCGGCGTCCAAATTCTG); the extracted protein is first quantified by the BCA method, and then the protein expression of IRBIT in each cell is detected by Western-Blot.

[0026] RT-qPCR and Western-Blot were used to detect the expression of IRBIT mRNA and protein in human gastric cancer cell lines and normal gastric mucosal cells GES-1.

[0027] 4. Clinical data and research The expression level of IRBIT in human gastric cancer tissues was detected, and the correlation between its expression level and the clinical pathological characteristics of patients was analyzed.

[0028] (1) Determine the expression of IRBIT in gastric cancer tissues: 50 samples of fresh human gastric cancer tissues and adjacent normal gastric tissues were collected (Shanghai Xinchao Company, in compliance with ethical review); RT-qPCR and Western-Blot were used to detect the expression of IRBIT in fresh human gastric cancer tissues and adjacent normal gastric tissues; in addition, paraffin-embedded gastric cancer tissues and adjacent normal gastric tissue specimens were made into 4 μm slice specimens; then dewaxing, hydration, antigen repair, serum blocking, primary antibody incubation, secondary antibody incubation, addition of SABC, addition of colorimetric agent, counterstaining, sealing, etc., and immunohistochemistry was used to detect the expression and localization of IRBIT in fresh human gastric cancer tissues and adjacent normal gastric tissues.

[0029] (2) Confirm the correlation between the expression level of IRBIT in gastric cancer tissue and the clinical pathological characteristics of patients: ① Purchase human gastric cancer tissue chips (150 cases) (Shanghai Xinchao Company, in compliance with ethical review); ② Immunohistochemistry staining, the method is the same as above; ③ Image J software was used to analyze the differential expression of IRBIT in human gastric cancer tissues and adjacent normal gastric tissues; ④Analyze the correlation between the expression level of IRBIT in human gastric cancer tissue and the clinical pathological characteristics of gastric cancer patients such as tumor size, TNM stage, differentiation and lymph node metastasis.

[0030] 5. Experimental results: Figure 1 A- Figure 1 B Results show: Immunohistochemistry detection showed that the protein expression of IRBIT in human gastric cancer tissue was higher than that in adjacent normal gastric tissue. Figure 1 C The results showed that RT-qPCR detection found that the expression of IRBIT mRNA in gastric cancer cell lines AGS, SGC7901 and BGC823 was higher than that in normal gastric mucosal cells GES-1; the expression of IRBIT mRNA in gastric cancer cell lines MKN45 and MGC803 was lower than that in normal gastric mucosal cells GES-1. Figure 1 D- Figure 1 The Western-blot results of E showed that the expression of IRBIT protein in gastric cancer cell lines AGS, SGC7901 and BGC823 was higher than that in normal gastric mucosal cells GES-1; the expression of IRBIT protein in gastric cancer cell lines MKN45 and MGC803 was lower than that in normal gastric mucosal cells GES-1. Figure 1 F- Figure 1 The results suggest that patients with high expression of IRBIT in gastric cancer tissues have larger tumors, advanced clinical stages, and are more likely to have lymph node metastasis. The above clinical pathological results of human gastric cancer cells and tissues suggest that IRBIT is a cancer-promoting factor in gastric cancer.

[0031] Embodiment 2 1. Experimental materials: The lentiviral strain overexpressing IRBIT was purchased from Shanghai Jima Pharmaceutical Technology Co., Ltd. (Order No.: 34268); the lentiviral strain knocking out IRBIT was purchased from Shanghai Jima Pharmaceutical Technology Co., Ltd. (Order No.: 34292); CCK-8 reagent was purchased from MCE, USA (Cat. No.: HY-K0301); phosphate buffered saline (PBS) was purchased from Qidu Pharmaceutical Biotechnology Co., Ltd. (Cat. No.: QB1002); RPMI1640 culture medium was purchased from Thermo Fisher Scientific, USA (Cat. No.: C11875500BT); nude mice were purchased from Beijing Huafukang Biotechnology Co., Ltd.

[0032] 2. The experimental reagents are prepared as follows: (1) Cell culture medium: by volume, the culture medium contains 90% basal culture fluid, 10% fetal bovine serum, and 1% streptomycin / penicillin; (2) Phosphate buffer: Dissolve 0.818 g NaCl, 0.037 g KCl, 0.022 g CaCl2, 0.238 g HEPES, and 0.18 g glucose in 90 mL ultrapure water, adjust the pH to 7.4, and dilute to 100 mL for later use; (3) Cell digestion solution: 0.25 g trypsin, add 0.02 g EDTA, add 70 mL PBS solution to dissolve, adjust the pH to 7.2-7.4, make up to 100 mL with ultrapure water, filter and sterilize, and use during cell culture and subculture; (4) Preparation of CCK-8 working solution: Inoculate each well of a 96-well plate with 100 μL of cell suspension to prepare CCK-8 solution. Add 10 μL of CCK-8 solution and 90 μL of serum-free culture medium to each well. Preheat the CCK-8 solution to room temperature before use and prepare it immediately before use.

[0033] 3. Cell experiment methods: (1) Cell recovery: Quickly remove the frozen MGC803 and BGC823 cells from liquid nitrogen and place them in an ice box. Then quickly put the cryotube into a water bath that has been preheated to 37°C to thaw quickly, and immediately take it into the clean bench. Pipette the cell freezing solution into the centrifuge tube that has been placed in the culture medium, and blow up and down to mix the freezing solution and complete culture medium thoroughly. Centrifuge at 800 rpm and 4°C for 5 min. After centrifugation, discard the supernatant, add 5 mL of culture medium to the cell pellet in the centrifuge tube, repeatedly blow and beat to make a cell suspension, put it into a culture bottle, and culture it in a cell culture incubator at 37°C and 5% CO2.

[0034] (2) Cell transfection: Cells can be transfected after 2-3 generations of passage. Before transfection, cells are plated in 6-well plates. After the cell growth density reaches 40%-50% confluence and the cells are observed to be in good condition, transfection can be performed. IRBIT was overexpressed in MGC803 gastric cancer cells that lowly express IRBIT; IRBIT was knocked down in BGC823 gastric cancer cells that highly express IRBIT. Positive cloned cell lines were selected with puromycin, and the selected cells were expanded to establish lines.

[0035] (3) CCK-8 assay was used to detect changes in cell proliferation after overexpression and knockdown of IRBIT; (4) Cell clone formation assay was used to detect changes in cell proliferation after overexpression and knockdown of IRBIT; (5) Nude mouse tumor formation experiments were used to detect the overall changes in tumors after overexpression and knockdown of IRBIT.

[0036] 4 Experimental results: (1) Construction results of IRBIT overexpression and knockdown cell lines: First, Western-blot and RT-qPCR verified the successful construction of IRBIT overexpression and knockdown cell lines. Figure 2 A- Figure 2 B Results show that: Western-blot analysis showed that IRBIT was successfully overexpressed in gastric cancer cell line MGC803 and successfully knocked down in gastric cancer cell line BGC823. Figure 2 C- Figure 2 D: RT-qPCR test verified that the mRNA expression of IRBIT in the MGC803 overexpression stable strain was significantly higher than that in the control group; the mRNA expression of IRBIT in the BGC823 knockdown stable strain was significantly lower than that in the control group; (2) CCK-8 experiment: After IRBIT overexpression, the cell proliferation activity was significantly increased compared with the control group; after IRBIT knockdown, the cell proliferation activity was significantly decreased compared with the control group; Figure 3 A- Figure 3 B: CCK-8 assay showed that the proliferation ability of cells in gastric cancer cell line MGC803 was significantly increased 24 h and 48 h after IRBIT overexpression; Figure 3 C- Figure 3 D: The proliferation ability of cells in gastric cancer cell line BGC823 was significantly decreased 24 h and 48 h after IRBIT knockdown; (3) Cell clone formation experiment: After IRBIT overexpression, the clone proliferation ability of cells increased compared with the control group; after IRBIT knockdown, the clone proliferation ability of cells weakened compared with the control group; Figure 4 A- Figure 4B: Cell clone formation experiment showed that the clone proliferation ability of cells was significantly increased after IRBIT was overexpressed in the gastric cancer cell line MGC803; Figure 4 C- Figure 4 D: After IRBIT knockdown in gastric cancer cell line BGC823, the clonal proliferation ability of cells was significantly reduced; (4) Nude mouse tumor formation experiment: After IRBIT overexpression, the size and volume of nude mouse tumors were significantly increased compared with the control group; after IRBIT knockdown, the size and volume of nude mouse tumors were significantly reduced compared with the control group. Figure 5 A- Figure 5 B: Nude mouse tumor formation experiment showed that the tumor volume of nude mice increased significantly after IRBIT was overexpressed in the gastric cancer cell line MGC803; Figure 5 C- Figure 5 D: After IRBIT knockdown in the gastric cancer cell line BGC823, the volume and weight of nude mouse tumors decreased significantly.

[0037] Embodiment 3 1. Experimental materials: Dimethyl sulfoxide (DMSO) was purchased from MCE, USA (Cat. No.: HY-B0572); calcium fluorescence detection reagent Fura-2, AM was purchased from Solebol (Cat. No.: F8500); SN-6 was purchased from MacLean (Cat. No.: S872232-5mg).

[0038] 2. The experimental reagents are prepared as follows: (1) Cell culture medium: by volume, the culture medium contains 90% basal culture fluid, 10% fetal bovine serum, and 1% streptomycin / penicillin; (2) Phosphate buffer: Dissolve 0.818 g NaCl, 0.037 g KCl, 0.022 g CaCl2, 0.238 g HEPES, and 0.18 g glucose in 90 mL double distilled water, adjust the pH to 7.4, and dilute to 100 mL for later use; (3) Cell digestion solution: 0.25 g trypsin, add 0.02 g EDTA, add 70 mL PBS solution to dissolve, adjust the pH to 7.2-7.4, make up to 100 mL with ultrapure water, filter and sterilize, and use during cell culture and subculture; (4) Calcium dye: Dissolve 100 μg of Fura-2, AM, a cell-permeable calcium fluorescent probe, in 45.6 μL DMSO (dimethyl sulfoxide) to prepare a 10 mM stock solution, and store it at -20°C in the dark. Before use, take 1 μL of Fura-2, AM stock solution, add 1 mL of phosphate buffer, preheat at 37°C, and prepare it before use; 3. Cell experiment experimental method: (1) Cell recovery: Quickly remove the frozen GES-1 and BGC823 cells from liquid nitrogen and place them in an ice box. Then quickly put the cryotube into a water bath that has been preheated to 37°C to thaw quickly, and immediately take it into the clean bench. Pipette the cell freezing solution into the centrifuge tube that has been placed in the culture medium, and blow up and down to mix the freezing solution and complete culture medium thoroughly. Centrifuge at 800 rpm and 4°C for 5 min. After centrifugation, aspirate and discard the supernatant, add 5 mL of culture medium to the cell pellet in the centrifuge tube, repeatedly blow and beat to make a cell suspension, put it into a culture bottle, and culture it in a cell culture incubator at 37°C and 5% CO2.

[0039] (2) Cell passaging: Cells can be passaged when their growth density reaches 80% to 90% confluence. Discard the old culture medium, wash away the remaining old culture medium with PBS, and repeat the wash twice. Discard the PBS, add the cell digestion solution and quickly spread evenly. Observe under a microscope. When about 70% to 80% of the cells shrink and become round, tap the outer wall of the culture container to make the cells detach from the culture surface. Immediately add culture medium with a volume of 2 times the digestion solution to terminate digestion. Use a pipette to gently blow all the cells off. Remove the supernatant after centrifugation. Add an appropriate amount of culture medium and gently blow to mix and set aside.

[0040] (3) GES-1 and BGC823 cells were cultured on a 15 mm diameter round transparent cell slide. When the cell density reached about 80%, the next step was carried out. (4) GES-1 and BGC823 cells were washed twice with phosphate buffer, and then calcium ion dye was added and incubated at 37°C for 1 h; (5) GES-1 and BGC823 cells were transferred to new cell culture dishes, washed three times with phosphate buffer, and incubated in phosphate buffer for 30 min; (6) Imaging was performed under a fluorescence microscope, with blue excitation light and green receiving light selected; the imaging interval was 3 s, and the final concentration was 5 μM. The green fluorescence intensity of the cells was recorded by imaging, and the change rate of calcium fluorescence was counted. The images were captured using an enhanced CCD camera (ICCD200) and MetaFluor imaging system (Universal Imaging); (7) First, the intracellular Ca was detected by laser confocal calcium imaging in normal human gastric mucosal cells GES-1. 2+ After the release of transient signals, IP3 hexapotassium salt, a recognized IP3 receptor agonist that can penetrate into cells, was administered, and intracellular Ca was detected by laser confocal calcium imaging. 2+ The transient signal released and the previous Ca 2+Next, the gastric cancer cells BGC823 with high expression of IRBIT were pretreated with the endoplasmic reticulum calcium chelator TPEN, and then the IP3 receptor agonist IP3 hexapotassium salt was used to detect intracellular Ca2+ by laser confocal calcium imaging. 2+ Then, gastric cancer cells BGC823 and gastric cancer cells BGC823 with knockdown of IRBIT gene expression were pretreated with endoplasmic reticulum calcium chelator TPEN, and then IP3 receptor agonist IP3 hexapotassium salt was used to detect intracellular Ca by laser confocal calcium imaging. 2+ The transient signals released were then compared to analyze and speculate the relationship between IRBIT and Ca2+ in gastric cancer. 2+ The possible mechanism of released transient signals in gastric cancer progression.

[0041] 4. Experimental results: Figure 6 A: Fura-2 AM was used to perform single-cell calcium imaging experiments, and it was found that the addition of IP3 receptor agonist IP3 hexapotassium salt (IP3HPS, 100 μM) could trigger the intracellular Ca2+ expression in normal human gastric mucosal cells GES-1. 2+ Signal. Figure 6 B: GES-1 cells, chelated with ER calcium chelator TPEN 2+ After IP3 hexapotassium salt was given, no intracellular Ca 2+ signal, and then give 5 Ca 2+ Detection of calcium signals indicates that the cells are alive and well. Figure 6 C: Gastric cancer cell BGC823, using ER calcium chelator TPEN to chelate ER Ca 2+ After IP3 hexapotassium salt was given, intracellular Ca 2+ Signal. Figure 6 D: Gastric cancer cells BGC823 were used as the control group, and the endoplasmic reticulum calcium chelator TPEN was used to chelate the endoplasmic reticulum Ca 2+ After IP3 hexapotassium salt was given, intracellular Ca 2+ Signal. Figure 6 E: After knockdown of IRBIT in gastric cancer cells BGC823, ER calcium chelator TPEN was used to chelate ER Ca 2+ After that, IP3 hexapotassium salt was given, and compared with the control group gastric cancer cell BGC823, the intracellular Ca2+-induced by IP3 hexapotassium salt was significantly inhibited. 2+ Signal. Figure 6 F: Statistical chart of 6D and 6E. Figure 6 G: Western-blot experiment verified that IRBIT was knocked down in BGC823 cells, and the expression of IRBIT protein was reduced, indicating that IRBIT knockdown was successful.

[0042] In summary, the present invention confirms through a large amount of experimental data that the expression level of IRBIT in human gastric cancer cells and tissues is higher than that in normal gastric mucosal cells, and analyzes that the expression level of IRBIT protein in gastric cancer tissue is negatively correlated with the clinical pathological characteristics and survival prognosis of patients; and through immunohistochemical large sample gastric cancer tissue chip, it is detected that the expression of IRBIT protein in gastric cancer tissue is higher than that in adjacent normal gastric tissue. IRBIT protein is highly expressed in gastric cancer tissue, and its expression level is positively correlated with tumor size, clinical stage and metastasis; IRBIT may regulate Ca in gastric cancer. 2+ Signals promote the proliferation, migration and invasion of gastric cancer cells.

[0043] The embodiments described above are only descriptions of the preferred implementation modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of a reagent for detecting IRBIT protein or its encoding gene in the preparation of a product for gastric cancer diagnosis or prognosis assessment.

2. Use of the reagent for detecting IRBIT protein or its encoding gene according to claim 1 in the preparation of a product for gastric cancer diagnosis or prognosis assessment, characterized in that: The IRBIT protein or the gene encoding it is used as a marker for gastric cancer diagnosis or gastric cancer prognosis assessment.

3. Use of the reagent for detecting IRBIT protein or its encoding gene according to claim 1 in the preparation of a product for gastric cancer diagnosis or prognosis assessment, characterized in that: IRBIT protein expression is upregulated in gastric cancer patients.

4. Use of the reagent for detecting IRBIT protein or its encoding gene according to claim 1 in the preparation of a product for gastric cancer diagnosis or prognosis assessment, characterized in that: The expression level of IRBIT protein in gastric cancer tissues of gastric cancer patients was negatively correlated with their clinical pathological characteristics and survival prognosis; IRBIT protein was upregulated in gastric cancer tissues of gastric cancer patients, and its expression level was positively correlated with tumor size, clinical stage and metastasis.

5. Use of the reagent for detecting IRBIT protein or its encoding gene according to claim 1 in the preparation of a product for gastric cancer diagnosis or prognosis assessment, characterized in that: Products for gastric cancer diagnosis or prognosis assessment include primers and probes for identifying IRBIT protein encoding genes, and antibodies for recognizing IRBIT proteins.

6. Use of the reagent for detecting IRBIT protein or its encoding gene according to claim 1 in the preparation of a product for gastric cancer diagnosis or prognosis assessment, characterized in that: The primers for identifying the IRBIT protein encoding gene include: a front primer sequence as shown in SEQ ID NO.1, and a rear primer sequence as shown in SEQ ID NO.

2.

7. A biomarker for gastric cancer diagnosis or prognosis assessment, characterized in that: The biomarkers include IRBIT protein or its encoding gene.

8. A kit for gastric cancer diagnosis or prognosis assessment, characterized in that: The kit is used for detecting IRBIT protein or its coding gene.

9. The kit for gastric cancer diagnosis or prognosis assessment according to claim 8, characterized in that: The kit comprises primers and probes for identifying the gene encoding the IRBIT protein, and antibodies for identifying the IRBIT protein.

10. Use of a preparation for inhibiting the expression of IRBIT protein or its encoding gene in the preparation of a drug for treating gastric cancer.

Images