Corn wip1 gene promoter and application thereof

A promoter, gene technology, applied in the field of plant genetic engineering, can solve problems such as gene silencing

Inactive Publication Date: 2013-01-23
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Gene silencing is easily achieved using the same promoter for multiple gene transformations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Corn wip1 gene promoter and application thereof
  • Corn wip1 gene promoter and application thereof
  • Corn wip1 gene promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1 Maize wip1 promoter cloning and sequence analysis

[0021] The sequence of the Zmwip1 gene registered in GenBank (accession number: X71396) was compared and analyzed on the maizesequence website, and the Bac sequence AC206573 containing this gene sequence was obtained. Primers were designed according to the Bac sequence to amplify the promoter sequence of Zmwip1. The designed primers are: forward primer 5′ATCTGCAGGGCTCCGTTCTACTTGACT 3′(SEQ ID No.3), PstI restriction site is introduced at the 5′ end, reverse primer 5′TGGATCCGGTCTCGGACGAGCTGTTCTT3′(SEQ ID No.4), BamH1 is introduced at the 5′ end Restriction sites. The promoter sequence of the Zmwip1 gene was amplified from the genomic DNA of maize inbred ensemble 31 by PCR amplification to obtain a 1737bp PCR product ( figure 1 ), the sequence after sequencing is shown in SEQ ID No.2.

[0022] PCR reaction system:

[0023]

[0024] PCR reaction program:

[0025]

[0026] The amplified PCR product was ...

Embodiment 2w

[0027] Embodiment 2 wip promoter fragment deletion and vector construction

[0028] 1. Primer design

[0029] According to the upstream sequence of the amplified 1737bp Zmwip1 gene, different primers were designed to amplify promoter fragments of different lengths. Wherein downstream primer 5'TGGATCCTTCCTCGTGATCATTTCCG 3'(SEQ ID No.5) and upstream primer 5'GCTGCAGCCTTACATAGTGGTTGGT 3'(SEQ ID No.6) amplify 1442bp promoter sequence, and upstream primer 5'GCTGCAGGGCGTCCATTTGTATCTC 3'(SEQ ID No. 7) Amplify the 1327bp promoter sequence, and the upstream primer 5'GCTGCAGTTTGTTTTGGATTATAATCTCTTC 3'(SEQ ID No.8) amplifies the 1231bp promoter sequence, and the upstream primer 5'GCTGCAGCGCGTCGCCGTCTCTTACTGT 3'(SEQ ID No.9) amplifies the 931bp promoter subsequence. The amplified PCR product was connected to the pGEM-T easy vector vector produced by Promega, and the gene was sequenced using the T7 and SP6 primers on the vector.

[0030] 2. PCR reaction procedure and conditions

[0031...

Embodiment 3

[0037] The acquisition of embodiment 3 transgenic tobacco and Arabidopsis

[0038] 1. Transformation of tobacco with expression vector

[0039] Take 200 μl of Agrobacterium LBA4404 competent cells, add 1 μg of each plasmid DNA constructed in Example 2, and use pCAMBIA1300-121 as a positive control. Quickly freeze in liquid nitrogen for 1 minute, bathe in water at 37°C for 5 minutes, then add 1ml of YEB medium, culture with slow shaking at 28°C for 4 hours; centrifuge at 1000rpm for 30 seconds, discard the supernatant, add 0.1ml of YEB medium to resuspend the cells, and spread on On the YEB plate containing 100 μg / ml kanamycin and 125 μg / ml streptomycin, culture at 28°C for about 48 hours. A single colony grown on the plate was picked, inoculated in YEB liquid culture medium, and cultured overnight at 28°C with shaking; a small amount of plasmid DNA was extracted, and the plasmid DNA was used as a template for PCR amplification and identification.

[0040] Inoculate the Agrob...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a corn wip1 gene promoter and application thereof. The promoter is a DNA fragment consisting of a nucleotide sequence shown as a SEQ ID No.1or a DNA functional fragment with starting gene expression and derived from 1) by substituting, deleting or adding one or a plurality of nucleotides on the nucleotide sequence shown as a SEQ ID No.1. According to results of conversingtobacco and Arabidopis thaliana, the promoter of the present invention can start expression of a GUS gene, has promoter activity and can be applied to heredity improvement and industrialized researchon crops of corn and paddy rice, etc.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to a maize wip1 gene promoter and application thereof. Background technique [0002] Plant promoters control the expression of plant genes. The expression strength of the foreign gene in transgenic plants also depends on the strength of the promoter in front of the foreign gene. Promoters can be classified into constitutive, inducible and tissue-specific promoters. Constitutive promoters allow genes to be expressed in all parts of the plant and at different developmental stages. The most widely used such promoters include: the 355 promoter from the tobacco mosaic virus, the Ubiquitin promoter of the maize ubiquitin gene, and the Actin promoter of the rice actin gene. Tissue-specific promoters can only express the target gene in specific organs or tissues of the plant, such as the maize Zm13 promoter can only express the target gene in pollen (Hanson DD et al.,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/82A01H5/00
Inventor王国英刘允军张生学练云
OwnerINST OF CROP SCI CHINESE ACAD OF AGRI SCI