Os-ER-ANT1 gene promoter for paddy rice and application thereof
An os-er-ant1 and promoter technology, applied in the field of plant genetic engineering, can solve problems such as biological insecurity, gene silencing, and activity decline
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Embodiment 1 Rice Os-ER-ANT1 promoter cloning and sequence analysis
[0025] The sequence of the Os-ER-ANT1 gene (accession number: LOC_Os11g43960) was compared and analyzed on the GenBank website, and a sequence containing about 700 bp upstream of the gene sequence was obtained. Combined with bioinformatics analysis, primers were designed according to this sequence to amplify the promoter sequence of Os-ER-ANT1. The designed primers are: forward primer 5'AAGCTTAAGAAGTTCTTGAGGTATAC3' (SEQ ID No.2), 5' end introduces HindIII restriction site, reverse primer 5'CCATGGCGTCGACGGCGGATTCGGAG-3' (SEQ ID No.3), 3' end introduces NcoI restriction site. The promoter sequence of the Os-ER-ANT1 gene was amplified from the genomic DNA of rice Zhonghua 11 by PCR amplification to obtain a 673bp PCR product ( figure 1 ), the sequence after sequencing is shown in SEQ ID No.1.
[0026] PCR reaction system:
[0027]
[0028] PCR reaction program:
[0029]
[0030]
[0031] Th...
Embodiment 2
[0034] The acquisition of embodiment 2 transgenic Arabidopsis and rice
[0035] 1. Transformation of Arabidopsis with expression vector
[0036] Take 200 μl of Agrobacterium GV3101 competent cells, add 1 μg of each plasmid DNA constructed in Example 1, quick-freeze in liquid nitrogen for 1 minute, bathe in 37°C for 5 minutes, then add 1ml of YEB medium, culture with slow shaking at 28°C for 4 hours; 1000rpm Centrifuge for 30 seconds, discard the supernatant, add 0.1ml YEB medium to resuspend the cells, spread on the YEB plate containing 50μg / ml rifampicin, 40μg / ml gentamicin and kanamycin, and culture at 28°C for about 48 hours. A single colony grown on the plate was picked, inoculated in YEB liquid culture medium, and cultured overnight at 28°C with shaking; a small amount of plasmid DNA was extracted, and the plasmid DNA was used as a template for PCR amplification and identification.
[0037] After Agrobacterium was cultured on a solid LB plate for 2-3 days, a single clon...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com