Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Os-ER-ANT1 gene promoter for paddy rice and application thereof

An os-er-ant1 and promoter technology, applied in the field of plant genetic engineering, can solve problems such as biological insecurity, gene silencing, and activity decline

Inactive Publication Date: 2015-06-03
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the 35S promoter of cauliflower mosaic virus is a promoter sequence cloned from the virus, which may have potential biological safety. The maize ubiquitin promoter has high activity in many tissues, but it also has limitations. For example, the activity in mature tissues is significantly reduced, and at the same time, the use of the same promoter can easily produce gene silencing when performing multigene transformation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Os-ER-ANT1 gene promoter for paddy rice and application thereof
  • Os-ER-ANT1 gene promoter for paddy rice and application thereof
  • Os-ER-ANT1 gene promoter for paddy rice and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1 Rice Os-ER-ANT1 promoter cloning and sequence analysis

[0025] The sequence of the Os-ER-ANT1 gene (accession number: LOC_Os11g43960) was compared and analyzed on the GenBank website, and a sequence containing about 700 bp upstream of the gene sequence was obtained. Combined with bioinformatics analysis, primers were designed according to this sequence to amplify the promoter sequence of Os-ER-ANT1. The designed primers are: forward primer 5'AAGCTTAAGAAGTTCTTGAGGTATAC3' (SEQ ID No.2), 5' end introduces HindIII restriction site, reverse primer 5'CCATGGCGTCGACGGCGGATTCGGAG-3' (SEQ ID No.3), 3' end introduces NcoI restriction site. The promoter sequence of the Os-ER-ANT1 gene was amplified from the genomic DNA of rice Zhonghua 11 by PCR amplification to obtain a 673bp PCR product ( figure 1 ), the sequence after sequencing is shown in SEQ ID No.1.

[0026] PCR reaction system:

[0027]

[0028] PCR reaction program:

[0029]

[0030]

[0031] Th...

Embodiment 2

[0034] The acquisition of embodiment 2 transgenic Arabidopsis and rice

[0035] 1. Transformation of Arabidopsis with expression vector

[0036] Take 200 μl of Agrobacterium GV3101 competent cells, add 1 μg of each plasmid DNA constructed in Example 1, quick-freeze in liquid nitrogen for 1 minute, bathe in 37°C for 5 minutes, then add 1ml of YEB medium, culture with slow shaking at 28°C for 4 hours; 1000rpm Centrifuge for 30 seconds, discard the supernatant, add 0.1ml YEB medium to resuspend the cells, spread on the YEB plate containing 50μg / ml rifampicin, 40μg / ml gentamicin and kanamycin, and culture at 28°C for about 48 hours. A single colony grown on the plate was picked, inoculated in YEB liquid culture medium, and cultured overnight at 28°C with shaking; a small amount of plasmid DNA was extracted, and the plasmid DNA was used as a template for PCR amplification and identification.

[0037] After Agrobacterium was cultured on a solid LB plate for 2-3 days, a single clon...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an Os-ER-ANT1 gene promoter for paddy rice and application of the Os-ER-ANT1 gene promoter. The promoter is a DNA functional fragment which is derived from 1) a DNA fragment which is formed by a nucleotide sequence shown in SEQ ID No.1 or 2) one or more nucleotides which is obtained by performing substitution, deficiency or addition on the nucleotide sequence shown in SEQ ID No.1 and is provided with a promoter gene. The test on transformed rice and Arabidopsis proves that the promoter can promote the expression of GUS genes, has the activity of the promoter, and can be applied to genetic improvement and industrial research on crops such as paddy rice, corns and the like.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to a rice ER-ANT1 gene promoter and application thereof. Background technique [0002] Highly active promoters have very good application prospects in plant gene function research and genetic improvement. Constitutive promoters are the earliest and most widely used type of promoters in plant genetic engineering. At present, the promoters used in plant genetic engineering that can strongly initiate gene transcription are mainly cauliflower mosaic virus 35S promoter, rice actin promoter and maize ubiquitin promoter. However, the 35S promoter of cauliflower mosaic virus is a promoter sequence cloned from the virus, which may have potential biological safety. The maize ubiquitin promoter has high activity in many tissues, but it also has limitations. For example, the activity in mature tissues is significantly reduced, and at the same time, the use of the same promo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/82A01H5/00
Inventor 杨建平张向前宋梅芳孟凡华侯佩郑旭苏亮
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com