Corn wip1 gene promoter and application thereof
A promoter and corn technology, applied in the field of plant genetic engineering, can solve problems such as gene silencing
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1 Maize wip1 promoter cloning and sequence analysis
[0021] The sequence of the Zmwip1 gene registered in GenBank (accession number: X71396) was compared and analyzed on the maizesequence website, and the Bac sequence AC206573 containing this gene sequence was obtained. Primers were designed according to the Bac sequence to amplify the promoter sequence of Zmwip1. The designed primers are: forward primer 5′ATCTGCAGGGCTCCGTTCTACTTGACT 3′(SEQ ID No.3), PstI restriction site is introduced at the 5′ end, reverse primer 5′TGGATCCGGTCTCGGACGAGCTGTTCTT3′(SEQ ID No.4), BamH1 is introduced at the 5′ end Restriction sites. The promoter sequence of the Zmwip1 gene was amplified from the genomic DNA of maize inbred ensemble 31 by PCR amplification to obtain a 1737bp PCR product ( figure 1 ), the sequence after sequencing is shown in SEQ ID No.2.
[0022] PCR reaction system:
[0023]
[0024] PCR reaction program:
[0025]
[0026] The amplified PCR product was ...
Embodiment 2w
[0027] Embodiment 2wip promoter fragment deletion and vector construction
[0028] 1. Primer design
[0029] According to the upstream sequence of the amplified 1737bp Zmwip1 gene, different primers were designed to amplify promoter fragments of different lengths. Wherein downstream primer 5'TGGATCCTTCCTCGTGATCATTTCCG 3'(SEQ ID No.5) and upstream primer 5'GCTGCAGCCTTACATAGTGGTTGGT 3'(SEQ ID No.6) amplify 1442bp promoter sequence, and upstream primer 5'GCTGCAGGGCGTCCATTTGTATCTC 3'(SEQ ID No. 7) Amplify the 1327bp promoter sequence, and the upstream primer 5'GCTGCAGTTTGTTTTGGATTATAATCTCTTC 3'(SEQ ID No.8) amplifies the 1231bp promoter sequence, and the upstream primer 5'GCTGCAGCGCGTCGCCGTCTCTTACTGT 3'(SEQ ID No.9) amplifies the 931bp promoter subsequence. The amplified PCR product was connected to the pGEM-T easy vector vector produced by Promega, and the gene was sequenced using the T7 and SP6 primers on the vector.
[0030] 2. PCR reaction procedure and conditions
[0031]...
Embodiment 3
[0037] The acquisition of embodiment 3 transgenic tobacco and Arabidopsis
[0038] 1. Transformation of tobacco with expression vector
[0039] Take 200 μl of Agrobacterium LBA4404 competent cells, add 1 μg of each plasmid DNA constructed in Example 2, and use pCAMBIA1300-121 as a positive control. Quickly freeze in liquid nitrogen for 1 minute, bathe in water at 37°C for 5 minutes, then add 1ml of YEB medium, culture with slow shaking at 28°C for 4 hours; centrifuge at 1000rpm for 30 seconds, discard the supernatant, add 0.1ml of YEB medium to resuspend the cells, and spread on On the YEB plate containing 100 μg / ml kanamycin and 125 μg / ml streptomycin, culture at 28°C for about 48 hours. A single colony grown on the plate was picked, inoculated in YEB liquid culture medium, and cultured overnight at 28°C with shaking; a small amount of plasmid DNA was extracted, and the plasmid DNA was used as a template for PCR amplification and identification.
[0040] Inoculate the Agrob...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com