Method for regulating gene expression by utilizing recombinase

A recombinase, genome technology, applied in the field of genetic engineering

Active Publication Date: 2020-09-25
GEMPHARMATECH CO LTD
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, genetic engineering technology has experienced nearly 50 years of development. Scientists have developed many gene regulation strategies, which can carry out various fine modification and regulation of gene expression. However, some regulation strategies still encounter problems in application and require better solution

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for regulating gene expression by utilizing recombinase
  • Method for regulating gene expression by utilizing recombinase
  • Method for regulating gene expression by utilizing recombinase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] It was verified that the recombinase recognition site containing the inverted repeat sequence capable of forming a stem-loop structure hinders the expression of downstream genes. Methods as below:

[0065] build as Figure 4 The plasmid vector pBSK-Neo2272L2 shown contains EM7 promoter, lox2272 recombinase recognition site and Neo coding sequence.

[0066] (1) Preparation of pBSK vector backbone

[0067] Use PrimeSTAR Max DNA Polymerase Mix (Takara # R045A), use the primers and templates listed in Table 1 to Table 4, and prepare the vector backbone and fragments by high-fidelity PCR amplification. The PCR reaction system is 50 μl, 35 cycles, PCR reaction system and program The setting of is common knowledge in the field, and those skilled in the art can reasonably set it according to the information of the primers. After PCR, add 1 μl DpnI directly to the reaction system and place it in a water bath at 37°C for 60 minutes, then perform agarose gel electrophoresis. Th...

Embodiment 2

[0109] Verify that inserting a spacer sequence between the recombinase recognition site and the downstream gene can initiate the expression of the downstream gene.

[0110] Methods as below:

[0111] With reference to the method of Example 1, the construction contains such as Figure 11 In the plasmid vector pBSK-Neo2272L2-EXT of the expression element shown, a spacer sequence (SEQ ID NO.5) was added between lox2272 and the Neo coding sequence. After sequencing, the results showed that the spacer sequence was added successfully.

[0112] The regulatory sequence information on the pBSK-Neo2272L2-EXT vector is as follows:

[0113] (GTTGACAATTAATCATCGGCATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACC) ataa cttcgtataggatactttatacgaagttat tgctggcaactagaaggcacagtcgaacc ATG GGATCGGCCATTGA ACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACA ATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGT CCGGTGCCCTGAATGAACTGCAGGACG...

Embodiment 3

[0123] Detect the expression of downstream genes promoted by spacers of different lengths and sequences.

[0124] Referring to the method of Example 1, construct a plasmid vector containing a stem-loop structure sequence, a spacer sequence and a coding sequence, and detect its resistance, the results are shown in Table 10 and Figure 12-Figure 14 .

[0125] Table 10 Different plasmid vectors (for the vector backbone, see Figure 24-Figure 25) partial sequence information and resistance test results

[0126]

[0127] The p15A vector carries Amp and Chl double-antibody markers, and the p15A-stem-5, p15A-stem-8 and p15A-stem-14 vectors are respectively added between the CAT promoter of the p15A vector and the Chl coding sequence to form a length of 5bp, 8bp and Sequence of the 14 bp stem-loop structure. Figure 12 The results show that when the inverted repeat sequence that can form a stem-loop structure is directly connected to the ATG of the Chl (chloramphenicol resistanc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for regulating gene expression by utilizing recombinase, belonging to the technical field of gene engineering. The method disclosed by the invention comprises a step of inserting a spacer sequence into a position between a recombinase recognition site and an ATG sequence of a target gene, wherein the spacer sequence is a sequence which cannot form a stem-loop structure, the length of the spacer sequence is not less than 5 bp, and the spacer sequence does not contain an ATG sequence or a complementary sequence thereof. According to the method, by introducing thespacer sequence, the problem that downstream target genes are not expressed due to residual recombinase recognition sites capable of forming stem-loop structures is effectively solved, and a novel strategy is provided for gene regulation.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for regulating gene expression by using recombinase. Background technique [0002] Genetic engineering technology is an indispensable technical means for the study of gene function. Rudolf Jaenisch created the world's first transgenic animal (mice) in 1974. So far, genetic engineering technology has experienced nearly 50 years of development. Scientists have developed many gene regulation strategies, which can carry out various fine modification and regulation of gene expression. However, some regulation strategies still encounter problems in application and require A better solution. [0003] In view of this, the present invention is proposed. Contents of the invention [0004] Regulating the expression of coding genes, such as turning off or turning on the expression of specific genes according to needs, is an important means of studying gene functions,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63
CPCC12N15/63C12N2800/30C12N2830/50
Inventor琚存祥张明坤赵静
OwnerGEMPHARMATECH CO LTD