Pig actinobacillus pleuropneumoniae constant-temperature detection primer group capable of avoiding false negative detection result and application of pig actinobacillus pleuropneumoniae constant-temperature detection primer group

Abstract

The invention discloses a pig actinobacillus pleuropneumoniae constant-temperature detection primer group capable of avoiding a false negative detection result and application of the pig actinobacillus pleuropneumoniae constant-temperature detection primer group, the pig actinobacillus pleuropneumoniae constant-temperature detection primer group comprises an xerD detection primer group and an internal standard primer group, and the detection primer group is an LAMP primer group taking a xerD gene of the pig actinobacillus pleuropneumoniae as a target gene, comprising an outer primer with a nucleotide sequence as shown in SEQ ID NO.1-2, an inner primer with a nucleotide sequence as shown in SEQ ID NO.3-4 and a loop primer with a nucleotide sequence as shown in SEQ ID NO.5-6. The internal standard primer group is an LAMP (Loop-Mediated Isothermal Amplification) primer taking an actinobacillus pleuropneumoniae apxIVA gene as an internal standard gene, and comprises outer primers with nucleotide sequences as shown in SEQ ID NO.7-8, inner primers with nucleotide sequences as shown in SEQ ID NO.9-10 and loop primers with nucleotide sequences as shown in SEQ ID NO.11-12. The method has the advantages that the detection time is short, the operation is easy, the endogenous reference gene is added on the basis of the isothermal amplification technology, the false negative is effectively identified, the detection accuracy of the actinobacillus pleuropneumoniae is facilitated, and the popularization and application of the constant-temperature detection method in detection are facilitated.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology detection, in particular to a detection technology of porcine Actinobacillus pleuropneumoniae. Background Art

[0002] Actinobacillus pleuropneumoniae (App) is the main pathogen of porcine contagious pleuropneumonia, which can cause exudative, fibrotic, necrotic and hemorrhagic pneumonia and pleurisy. The disease has a very high morbidity and mortality rate, but it is latent in most cases. It is reported that clinically healthy pigs still have pathogens parasitic in their upper respiratory tract, which is the main cause of the spread of porcine Actinobacillus pleuropneumoniae and the main cause of decreased weight gain rate, decreased feed conversion rate and extended time to market. This pathogen has caused huge economic losses to the global breeding industry. Early diagnosis of subclinically infected pigs is the key to controlling the disease, but the diagnosis of subclinically infected pigs is very difficult.

[0003] 19 serotypes of porcine Actinobacillus pleuropneumoniae have been found so far, and their prevalence varies geographically. Among them, types 1, 5, 9, 11 and 12 are usually very virulent, while types 3 and 6 are relatively mild. This bacterium mainly parasitizes the tonsils and upper respiratory tract. The pathogen is spread over a short distance through droplets or aerosols and can only survive for a few days in the in vitro environment. There are several virulence factors for APP to cause disease in pigs, including capsular polysaccharides, lipopolysaccharides, outer membrane proteins, transferrin-binding proteins, proteases, permeability factors and hemolysins. Among all the pathogenic factors, the most important is hemolysin (RTX). APP exotoxin (Actinobacillus pleuropeumoniae-RTX-toxin, Apx) has cytotoxic effects on many cells, including macrophages. APP can secrete at least 4 different types of Apx hemolysins, namely ApxⅠ, ApxⅡ, ApxⅢ and ApxⅣ. Among them, ApxⅠ has strong hemolytic activity, ApxⅡ has weak hemolytic activity, ApxⅢ has only cytotoxicity and no hemolytic activity, and ApxⅣ is produced by all APP serotypes in infected pigs, but not under in vitro culture conditions. The product expressed by Escherichia coli has weak hemolytic activity. Based on the conservative type of ApxⅣ gene, many articles report using it as a target gene sequence for molecular biological gene diagnosis of porcine pleuropneumonia. In recent years, articles have reported that many new DNA markers of porcine Actinobacillus pleuropneumoniae have been mined through whole genome sequencing technology, such as eamA, nusG, sppA, xerD, ybbN, ycfL and ychJ genes. Among them, xerD is a gene encoding tyrosine recombinase, which is highly conserved in porcine Actinobacillus pleuropneumoniae and can be used for rapid diagnosis of porcine Actinobacillus pleuropneumoniae, providing favorable data support for early prevention and control of the disease.

[0004] In recent years, a variety of molecular biological detection methods, including enzyme-linked immunosorbent assay (ELISA), in situ hybridization, conventional PCR, nested PCR and real-time fluorescence quantitative PCR, have been developed for the diagnosis and detection of App. Among them, various PCR-based detection methods have high sensitivity and good specificity and are most widely used in laboratory testing; however, these methods require expensive instruments and equipment, high testing costs and high technical requirements for testers, which limits their practical application in pig farms. Therefore, it is urgent to establish a rapid, sensitive, instant detection, high-throughput and low-instrumentation porcine Actinobacillus pleuropneumoniae detection kit and detection method that can identify false negative test results. Summary of the invention

[0005] The purpose of the present invention is to provide a constant temperature detection primer set for porcine Actinobacillus pleuropneumoniae and its application which can avoid false negative detection results, so as to solve the problem of how to detect porcine Actinobacillus pleuropneumoniae quickly, sensitively, instantly, with high throughput and without high requirements on instruments.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A constant temperature detection primer set for porcine Actinobacillus pleuropneumoniae which can avoid false negative detection results, comprises a xerD detection primer set and an internal standard primer set, wherein the xerD detection primer set is a LAMP primer set with the porcine Actinobacillus pleuropneumoniae xerD gene as a target gene, comprising outer primers with nucleotide sequences as shown in SEQ ID NOs.1-2, inner primers with nucleotide sequences as shown in SEQ ID NOs.3-4, and loop primers with nucleotide sequences as shown in SEQ ID NOs.5-6; and the internal standard primer set is a LAMP primer with the porcine Actinobacillus pleuropneumoniae apxIVA gene as an internal standard gene, comprising outer primers with nucleotide sequences as shown in SEQ ID NOs.7-8, inner primers with nucleotide sequences as shown in SEQ ID NOs.9-10, and loop primers with nucleotide sequences as shown in SEQ ID NOs.11-12.

[0008] The present invention also provides an application of the constant temperature detection primer set for Actinobacillus pleuropneumoniae which can avoid false negative detection results in the preparation of a detection kit.

[0009] More preferably, the detection kit comprises the xerD detection primer set, the internal standard primer set, the LAMP reaction solution, Bst DNA polymerase, 10×SYBR Green I, a positive control, a negative control and an internal standard.

[0010] More preferably, the positive control is a T vector clone containing a partial fragment of the xerD gene of Actinobacillus pleuropneumoniae; the internal standard is a T vector clone containing a partial fragment of the apxIVA gene; and the negative control is ultrapure water.

[0011] More preferably, the internal standard concentration is 1 fg / μL, which is the minimum detection limit of the internal standard primer set.

[0012] Preferably, the LAMP reaction solution comprises 6-8 mM dNTP, 10×ThermoPol reaction buffer, 120-160 mM MgSO 4 The volume ratio of the three is 8:4:3.

[0013] More preferably, the isothermal amplification reaction system and conditions constructed using the xerD detection primer set, 25 μL of the reaction system contains: 0.2 μM of the primer xerD-F3 shown in SEQ ID NO.1, 0.2 μM of the primer xerD-B3 shown in SEQ ID NO.2, 3.2 μM of the primer xerD-FIP shown in SEQ ID NO.3, 3.2 μM of the primer xerD-BIP shown in SEQ ID NO.4, 1.6 μM of the primer xerD-LF shown in SEQ ID NO.5, 1.6 μM of the primer xerD-LB shown in SEQ ID NO.6, 12.5 μL of LAMP reaction solution, 8 U of Bst DNA polymerase, 0.5 μL of 10×SYBR Green I, 2 μL of the sample to be tested, and the mixture is filled up to 25 μL with ultrapure water; negative control and positive control are set;

[0014] The LAMP isothermal amplification procedure was as follows: 63–65°C for 30–60 min and 80°C for 2 min;

[0015] An internal standard primer set was used to construct a constant temperature amplification internal standard reaction system and conditions. A 25 μL reaction system contained: primer apxIVA-F3 0.2 μM as shown in SEQ ID NO.7, primer apxIVA-B3 0.2 μM as shown in SEQ ID NO.8, primer apxIVA-FIP 3.0 μM as shown in SEQ ID NO.9, primer apxIVA-BIP 3.0 μM as shown in SEQ ID NO.10, primer apxIVA-LoopF ​​1.6 μM as shown in SEQ ID NO.11, apxIVA-LoopB 1.6 μM as shown in SEQ ID NO.12, LAMP reaction solution 12.5 μL, BstDNA polymerase 8U, 10×SYBR Green I 0.5 μL, sample to be tested 2 μL, internal standard 2 μL, and the mixture was filled up to 25 μL with ultrapure water; a negative control was set;

[0016] The LAMP isothermal amplification procedure was as follows: 63–65°C for 30–60 min and 80°C for 2 min;

[0017] After the reaction is completed, the following is judged based on the xerD gene detection results and the internal standard gene apxIVA detection results:

[0018] When the xerD gene test result is positive and the internal standard gene test results are all positive, the test result is positive;

[0019] When the xerD gene test result is negative and the internal standard gene test results are all positive, the test result is negative;

[0020] When the xerD gene test result is positive and the internal standard gene test results are all negative, the test result is positive;

[0021] When the xerD gene test result is negative and the internal standard gene test results are all negative, the test result may be a false negative. It is recommended to re-extract DNA for testing.

[0022] Compared with the prior art, the present invention has the following advantages:

[0023] Constant temperature amplification technology has the advantages of short detection time and easy operation. Adding internal standard genes to the constant temperature amplification technology can provide an effective method for identifying false negative detection results, which is beneficial to improving the accuracy of the detection and is conducive to the promotion and application of the constant temperature detection method in detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The drawings described herein are used to provide a further understanding of the present invention, constitute a part of the present application, and do not constitute an improper limitation of the present invention. In the drawings:

[0025] Figure 1 3 is a graph showing the results of the sensitivity experiment of the internal standard gene of Actinobacillus pleuropneumoniae in Example 3;

[0026] Figure 2 This is a graph showing the results of the sensitivity verification experiment of the internal standard gene of Actinobacillus pleuropneumoniae in Example 3;

[0027] Figure 3 This is a graph showing the minimum detection rate of the xerD gene of Actinobacillus pleuropneumoniae in Example 3;

[0028] Figure 4 is a graph showing the specificity experimental results in Example 4;

[0029] Figure 5 This is a graph showing the test results of a sample without inhibitors in Example 5;

[0030] Figure 6This is a graph showing the test results of samples containing inhibitory factors in Example 5. DETAILED DESCRIPTION

[0031] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments. The exemplary embodiments and descriptions of the present invention are used to explain the present invention, but are not intended to limit the present invention.

[0032] Example 1 LAMP detection related reagents for Actinobacillus pleuropneumoniae

[0033] Prepare LAMP detection-related reagents for Actinobacillus pleuropneumoniae, including xerD detection primer set, internal standard primer set, LAMP reaction solution, Bst DNA polymerase, 10×SYBR Green I, positive control, negative control and internal standard.

[0034] (1) xerD detection primer set: LAMP primers with the xerD gene of Actinobacillus pleuropneumoniae as the target gene, including a pair of outer primers, a pair of inner primers and a pair of loop primers, and their nucleotide sequences are as follows:

[0035] xerD-F3 (SEQ ID NO.1): 5'-TCCCTCGCGACTTGG-3';

[0036] xerD-B3 (SEQ ID NO.2): 5'-ACTTGGAATCCTTCTCCGA-3';

[0037] xerD-FIP (SEQ ID NO.3): 5'-CGAATTGGTATCGCTTAGCATAGATTCTTCACCTATCGGTACTAATCT-3';

[0038] xerD-BIP (SEQ ID NO.4): 5'-AAGTGAGAGTAGGATCGTCTTGACTATAAGGCAACCAGTTCAGC-3';

[0039] xerD-LF (SEQ ID NO.5): 5'-CTTACGCCAAGGTGTGGT-3';

[0040] xerD-LB (SEQ ID NO.6): 5'-TTACGCAAGCAACTAAGCATTC-3';

[0041] (2) Internal standard primer set: LAMP primers using the apxIVA gene of Actinobacillus pleuropneumoniae as the internal standard gene, including a pair of outer primers, a pair of inner primers and a pair of loop primers, and their nucleotide sequences are as follows:

[0042] apxIVA-F3 (SEQ ID NO.7): 5'-GGTGTCATCGCCATTACC-3';

[0043] apxIVA-B3 (SEQ ID NO.8): 5'-ATATTCCCGACAGTGCGAAC-3';

[0044] apxIVA-FIP (SEQ ID NO.9): 5'-ACCGCAGTATAACTCGTGATGAACGGCATCAATCACCGAGTT-3';

[0045] apxIVA-BIP (SEQ ID NO.10): 5'-TTATCGTGACCGAATCCGTATCATGATGTCAATTATGCGGAAGTGA-3';

[0046] apxIVA-LoopF ​​(SEQ ID NO.11): 5'-TGACGTGATGATAATATCAACGA-3';

[0047] apxIVA-LoopB (SEQ ID NO. 12): 5'-AAGTCATCATCTACTCGTCGGAATT-3'.

[0048] (3) LAMP reaction solution: 6-8 mM dNTP, 10× ThermoPol reaction buffer, 120-160 mM MgSO 4 Aqueous solution, the volume ratio of the three is 8:4:3.

[0049] (4) The positive control is a T-vector clone containing a partial fragment of the xerD gene of Actinobacillus pleuropneumoniae. The preparation method is as follows: using the isolated and identified Actinobacillus pleuropneumoniae as a template, amplifying using xerD outer primers (SEQ ID NO: 1 and SEQ ID NO: 2), and the sequence of the obtained xerD gene amplified fragment is shown in SEQ ID NO: 13. The amplified fragment is recovered and ligated into a T-vector using a conventional method, which is the positive control.

[0050] SEQ ID NO.13:

[0051] TCCTCGGCGACTTGGAAAAACAACATCTGATTGTAGATTATTTAATAATATTGCACGCCCATACCGAAAGAATTCTTGAATCCAATAACCGGCTTCTTCACCTATCGGTACTAATCTCTCTTTATCGCCTTTCCCCA CAACACGTACCACACCTTGGCGTAAGCTTAGATTATCTATGCTAAGCGATACCAATTCGCTAACACGTAACCCCGTTGCATACAGTAATTCTAACATTGCTTTATCGCGTAATTCGATAGGATCTAACGTATTCGGA CTATCCAATAAATCCATTACTTGCTCTTCACTTAAAGATTTAGGCAAATGCGCCGGCTTACGCGGAGAAGTTAAAGTGAGAGTAGGATCGTCTTGACGATAATTTTCCGTATATAAAAAACGGAAAAATTTACGCAA GCAACTAAGCATTCTAGCTGAACTGGTTGCCTTATAGCCCAGTTCCAATCTTCCTCCCCAAGAATGCTTGCAGGTCAAAATGATCTAAAGTAAGAAATGCTTTTAGGCGTAGGTAACCATTCGGAGAAGGATTCCAAGT

[0052] (5) The internal standard is a T-vector clone containing a partial fragment of the apxIVA gene. The isolated and identified porcine Actinobacillus pleuropneumoniae is used as a template and amplified using apxIVA external primers (SEQ ID NO: 7 and SEQ ID NO: 8). The sequence of the amplified fragment of the apxIVA gene obtained is shown in SEQ ID NO: 14. The amplified fragment is recovered and ligated into the T-vector using conventional methods to serve as the internal standard.

[0053] SEQ ID NO:14

[0054] GGTGTCATCGCCATTACCGCCATTAACCGTATCATTACCCGCACCGGCATCAATCACCGAGTTACGTCCCCAGTCGTTGATATTATCATCACCGTCAGTGCCAAATAATGCCATACCTTGTTTACCTAGTTCATCACGAGTTATACTGCGGTCAGCAAATTCCAATTTGTCAAATTGATAATCTACATGGTTGTAGAAGGATTTTATCGTGACCGAATCCGTATCA TGATAACCGAATAACATTAAGTCATTATCTACTCGTCGGAATTTCACTTCCGCATAATTGACATCGGTAAATTTTAAGGTATCAATATCTCTTTAGAGTTCGCACTGTCGGAATATTCATAAATTACATCCTGTCCATGCCCTTTGCTAAAGATATAGGTGTCCGCACCGTAGCTGCCTCTTAAAATATCGTTACCTTTGCCACCTTCCAAAATACTGTCCCAAT CCGCATGATCATTAATTTCATCATTACCGTCGGTGCCGTATAGATGAAGACCCGCTTTAATCAGTTCGTCACGGCTTATACTACGGTCAGCAAATTCCAATTTCTCAAATTGATAATACTCATGGTCATAGAAGGATTT TACCGTGACTGAATCTGTATCGTGATAACCGAATAGCATTAAGTCATCACCTACCCGGCGGAATTTCACTTCCGCATAATTAACATCGGTAAATTTTAAGGTATCAATATCTCTTTTTAGAGTTCGCACTGTCGGAATAT

[0055] (6) The negative control was ultrapure water.

[0056] Example 2 LAMP detection method for Actinobacillus pleuropneumoniae

[0057] The samples were tested using the LAMP detection-related reagents for Actinobacillus pleuropneumoniae of Example 1, and the steps were as follows:

[0058] (1) Extracting DNA from samples to be tested;

[0059] (2) Using the detection primer set of Example 1, a constant temperature amplification detection reaction system was constructed, wherein the 25 μL reaction system contained: xerD-F3 0.2 μM, xerD-B3 0.2 μM, xerD-FIP 3.2 μM, xerD-BIP 3.2 μM, xerD-LF 1.6 μM, xerD-LB 1.6 μM, LAMP reaction solution 12.5 μL, Bst DNA polymerase 8U, 10×SYBR Green I 0.5 μL, and the sample to be tested 2 μL, which was filled up to 25 μL with ultrapure water; a positive control and a negative control were set; the prepared PCR tube was mixed and centrifuged, reacted at 63-65° C. for 30-60 min, and continued at 80° C. for 2 min;

[0060] (3) Use the internal standard primer set of Example 1 to construct a constant temperature amplification internal standard reaction system, 25 μL of the reaction system contains: apxIVA-F3 0.2 μM, apxIVA-B3 0.2 μM, apxIVA-FIP 3.0 μM, apxIVA-BIP 3.0 μM, apxIVA-LoopF ​​1.6 μM, apxIVA-LoopB 1.6 μM, LAMP reaction solution 12.5 μL, BstDNA polymerase 8U, 10×SYBR Green I 0.5 μL, the sample to be tested 2 μL, the internal standard 2 μL, and make up to 25 μL with ultrapure water; set a negative control; mix the prepared PCR tube and centrifuge it, and react at 63-65°C for 30-60 min, and continue at 80°C for 2 min;

[0061] (4) Result judgment: Place the reaction tube in a constant temperature fluorescence detector or a fluorescence PCR instrument, read the fluorescence signal in real time, and make judgments based on the xerD gene detection results and the internal standard gene apxIVA detection results:

[0062] When the xerD gene test result is positive and the internal standard gene test results are all positive, the test result is positive;

[0063] When the xerD gene test result is negative and the internal standard gene test results are all positive, the test result is negative;

[0064] When the xerD gene test result is positive and the internal standard gene test results are all negative, the test result is positive;

[0065] When the xerD gene test result is negative and the internal standard gene test results are all negative, the test result may be a false negative. It is recommended to re-extract DNA for testing.

[0066] Example 3 Sensitivity Experiment

[0067] In this example, a sensitivity experiment was performed on the internal standard constructed in Example 1. The 1 ng / μL internal standard was diluted 10 times to a gradient concentration of 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, 1 fg / μL, 0.1 fg / μL, etc., and the method of Example 2 was used for detection. The sensitivity experiment determined that the minimum detection limit of the internal standard gene was 1 fg / μL. Figure 1 As shown; and the minimum detection limit was reviewed, the results are as follows Figure 2 As shown; 1fg / μL internal standard concentration was set as the minimum detection limit concentration.

[0068] The results of positive control tested by the method of Example 2 are shown in Figure 2 .

[0069] The porcine Actinobacillus pleuropneumoniae was cultured and then diluted 10 times in a gradient manner. DNA was extracted from each concentration and tested one by one using the method of Example 2. The diluted bacterial solution was plate cultured and counted. The plate culture count results were compared with the above-mentioned porcine Actinobacillus pleuropneumoniae concentration detection results. It can be seen that the minimum detection rate of the detection method of Example 2 for porcine Actinobacillus pleuropneumoniae is 1.2×10 2 CFU / mL, test results are shown in Figure 3 .

[0070] Example 4 Specificity Experiment

[0071] The method of Example 2 was used to detect Streptococcus suis (SS), porcine transmissible gastroenteritis virus (TGEV), classical swine fever virus (CSFV), porcine blue ear virus (PRRSV), porcine circovirus type 2 (PCV-2), Haemophilus parasuis (HPS), Escherichia coli, Staphylococcus aureus, Pasteurella multocida, and clinical serum samples of healthy pigs. The results showed that the positive control and internal standard gene amplification were positive, and the DNA of Streptococcus suis (SS), porcine transmissible gastroenteritis virus (TGEV), classical swine fever virus (CSFV), porcine blue ear virus (PRRSV), porcine circovirus type 2 (PCV-2), Haemophilus parasuis (HPS), Escherichia coli, Staphylococcus aureus, Pasteurella multocida, and clinical serum samples of healthy pigs were not amplified. The results are as follows Figure 4 shown.

[0072] Example 5 Actual sample detection

[0073] Samples without inhibitors and samples with inhibitors were tested at the same time, and sensitivity tests were added to assist in judging the results. The detection methods and results are as follows:

[0074] 1. Extract DNA from samples to be tested:

[0075] 1) Take 1-2 ml of the bacterial solution of Actinobacillus pleuropneumoniae without EDTA inhibitor and 1-2 ml of the bacterial solution of Actinobacillus pleuropneumoniae with EDTA inhibitor, centrifuge at 12000 rpm for 5 min, and discard the supernatant;

[0076] 2) Add 500 μL of 0.8% NaCl aqueous solution or medical saline to the two kinds of porcine pleuropneumoniae obtained in the previous step, centrifuge at 12000 rpm for 5 min, and discard the supernatant as much as possible;

[0077] 3) Add 100 μL of DNA extraction solution to each of the two bacterial precipitates obtained in the previous step, vortex vigorously to mix, heat at 100°C for 10 min, and then quickly cool in a -20°C refrigerator for 10 min;

[0078] 4) Centrifuge at 12000 rpm for 2 min, transfer the supernatant to a new centrifuge tube for later use, and use 2 μL of the supernatant for gene amplification.

[0079] 2. Constant temperature gene amplification detection reaction system and conditions: 25 μL reaction system contains: xerD-F3 0.2 μM, xerD-B3 0.2 μM, xerD-FIP 3.2 μM, xerD-BIP 3.2 μM, xerD-LF 1.6 μM, xerD-LB 1.6 μM, LAMP reaction solution 12.5 μL, Bst DNA polymerase 8U, 10×SYBR Green I 0.5 μL, 2 μL of the sample to be tested, and make up to 25 μL with ultrapure water; set up positive control and negative control; mix the prepared PCR tube and centrifuge it, and react at 63-65°C for 30-60 min, and continue at 80°C for 2 min;

[0080] (3) Constant temperature gene amplification internal standard reaction system and conditions: 25 μL reaction system contains: apxIVA-F3 0.2 μM, apxIVA-B3 0.2 μM, apxIVA-FIP 3.0 μM, apxIVA-BIP 3.0 μM, apxIVA-LoopF ​​1.6 μM, apxIVA-LoopB 1.6 μM, LAMP reaction solution 12.5 μL, BstDNA polymerase 8 U, 10×SYBR Green I 0.5 μL, sample to be tested 2 μL, internal standard 2 μL, and fill up to 25 μL with ultrapure water; set up a negative control; mix the prepared PCR tube and centrifuge it, react at 63-65°C for 30-60 min, and continue at 80°C for 2 min;

[0081] (4) Result judgment: Place the above reaction tube in a constant temperature fluorescence detector or a fluorescence PCR instrument (such as ABI 7500), and judge the amplification result based on the fluorescence signal read in real time by the instrument. Judge based on the xerD gene detection result and the internal standard gene apxIVA detection result.

[0082] The results of the samples without inhibitors are shown in Figure 5 The positive control, internal standard gene, internal standard test and sample test results are positive, and the test results are normal. The test results of samples containing inhibitors are shown in Figure 6 , the positive control and internal standard gene test results are positive, the test results are normal, but the internal standard and sample test results are negative, indicating that the test results may be false negative test results, and the sample contains inhibitory factors that cause abnormal test results. The above experiments prove that this method can effectively identify whether the test results are false negative.

[0083] The present invention sets up an internal standard gene detection tube at the same time when testing the sample tube, and has the following characteristics:

[0084] 1) The internal standard gene and the actual sample are not tested in the same tube.

[0085] 2) The amplification target of the internal standard gene is different from the amplification target in the sample test tube,

[0086] 3) The nucleic acid concentration of the amplification target of the internal standard gene is near the detection line of the internal standard gene, and slight reaction inhibition can be identified. Under normal circumstances, since a low concentration of the internal standard target fragment is added to the internal standard detection tube at the same time as the sample extract, the detection result of the internal standard detection tube is positive. If the detection result of the internal standard tube is negative, it indicates that the sample extract contains inhibitors or other reasons, resulting in the inability of the internal standard detection tube to perform an amplification reaction. Similarly, the sample detection tube may also be unable to perform normal amplification detection due to inhibitors or other reasons, resulting in a false negative detection result of the sample detection tube. Therefore, this method can assist in judging that the sample detection result may be a false negative result based on the detection result of the internal standard tube.

[0087] The technical solutions provided by the embodiments of the present invention are introduced in detail above. Specific examples are used herein to illustrate the principles and implementation methods of the embodiments of the present invention. The description of the above embodiments is only applicable to help understand the principles of the embodiments of the present invention. At the same time, for those skilled in the art, according to the embodiments of the present invention, there will be changes in the specific implementation methods and application scopes. In summary, the content of this specification should not be understood as limiting the present invention.

Claims

1. A constant temperature detection primer set for Actinobacillus pleuropneumoniae that can avoid false negative test results, characterized in that: The invention comprises a xerD detection primer set and an internal standard primer set. The xerD detection primer set is a LAMP primer set with the xerD gene of porcine Actinobacillus pleuropneumoniae as the target gene, comprising an outer primer with a nucleotide sequence as shown in SEQ ID NOs.1-2, an inner primer with a nucleotide sequence as shown in SEQ ID NOs.3-4, and a loop primer with a nucleotide sequence as shown in SEQ ID NOs.5-6; the internal standard primer set is a LAMP primer with the apxIVA gene of porcine Actinobacillus pleuropneumoniae as the internal standard gene, comprising an outer primer with a nucleotide sequence as shown in SEQ ID NOs.7-8, an inner primer with a nucleotide sequence as shown in SEQ ID NOs.9-10, and a loop primer with a nucleotide sequence as shown in SEQ ID NOs.11-12.

2. Use of the constant temperature detection primer set for Actinobacillus pleuropneumoniae according to claim 1, which can avoid false negative detection results, in the preparation of a detection kit.

3. The use of a constant temperature detection primer set for Actinobacillus pleuropneumoniae according to claim 2, which can avoid false negative test results, in the preparation of a detection kit, characterized in that: The detection kit comprises the xerD detection primer set according to claim 1, an internal standard primer set, a LAMP reaction solution, BstDNA polymerase, 10×SYBR Green I, a positive control, a negative control and an internal standard.

4. The use of a constant temperature detection primer set for Actinobacillus pleuropneumoniae according to claim 3 in the preparation of a detection kit, characterized in that: The positive control is a T vector clone containing a partial fragment of the xerD gene of Actinobacillus pleuropneumoniae; the internal standard is a T vector clone containing a partial fragment of the apxIVA gene; and the negative control is ultrapure water.

5. The use of a constant temperature detection primer set for Actinobacillus pleuropneumoniae according to claim 4 in the preparation of a detection kit, characterized in that: The internal standard concentration is 1 fg / μL, the minimum detection limit of the internal standard primer set.

6. Use of a constant temperature detection primer set for Actinobacillus pleuropneumoniae according to claim 4 that can avoid false negative detection results in the preparation of a detection kit, characterized in that: The LAMP reaction solution includes 6-8mM dNTP, 10×ThermoPol reaction buffer, and 120-160mM MgSO4 aqueous solution, and the volume ratio of the three is 8:4:

3.

7. Use of a constant temperature detection primer set for Actinobacillus pleuropneumoniae according to claim 5 that can avoid false negative detection results in the preparation of a detection kit, characterized in that: The isothermal amplification reaction system and conditions constructed using the xerD detection primer set, 25 μL of the reaction system contains: 0.2 μM of the primer xerD-F3 shown in SEQ ID NO.1, 0.2 μM of the primer xerD-B3 shown in SEQ ID NO.2, 3.2 μM of the primer xerD-FIP shown in SEQ ID NO.3, 3.2 μM of the primer xerD-BIP shown in SEQ ID NO.4, 1.6 μM of the primer xerD-LF shown in SEQ ID NO.5, 1.6 μM of the primer xerD-LB shown in SEQ ID NO.6, 12.5 μL of LAMP reaction solution, 8 U of Bst DNA polymerase, 0.5 μL of 10×SYBR Green I, 2 μL of the sample to be tested, and the mixture is filled up to 25 μL with ultrapure water; negative control and positive control are set; The LAMP isothermal amplification procedure was as follows: 63–65°C for 30–60 min and 80°C for 2 min; An internal standard primer set was used to construct a constant temperature amplification internal standard reaction system and conditions. A 25 μL reaction system contained: primer apxIVA-F3 0.2 μM as shown in SEQ ID NO.7, primer apxIVA-B3 0.2 μM as shown in SEQ ID NO.8, primer apxIVA-FIP 3.0 μM as shown in SEQ ID NO.9, primer apxIVA-BIP 3.0 μM as shown in SEQ ID NO.10, primer apxIVA-LoopF ​​1.6 μM as shown in SEQ ID NO.11, apxIVA-LoopB 1.6 μM as shown in SEQ ID NO.12, LAMP reaction solution 12.5 μL, Bst DNA polymerase 8U, 10×SYBR Green I 0.5 μL, sample to be tested 2 μL, internal standard 2 μL, and the mixture was filled up to 25 μL with ultrapure water; a negative control was set; The LAMP isothermal amplification procedure was as follows: 63–65°C for 30–60 min and 80°C for 2 min; After the reaction is completed, the following is judged based on the xerD gene detection results and the internal standard gene apxIVA detection results: When the xerD gene test result is positive and the internal standard gene test results are all positive, the test result is positive; When the xerD gene test result is negative and the internal standard gene test results are all positive, the test result is negative; When the xerD gene test result is positive and the internal standard gene test results are all negative, the test result is positive; When the xerD gene test result is negative and the internal standard gene test results are all negative, the test result may be a false negative. It is recommended to re-extract DNA for testing.

Images