Kit for detecting iridovirus of micropterus salmoides

Abstract

The invention discloses a kit for detecting iridovirus of micropterus salmoides. The kit for detecting the largemouth bass iridovirus (LMBV) is constructed by utilizing a DNA (Deoxyribonucleic Acid) nucleic acid aptamer for specifically recognizing largemouth bass iridovirus (LMBV) particles and combining an isothermal strand displacement amplification reaction (SDA) and a colloidal gold (AuNPs) labeling technology. The kit provided by the invention can realize rapid visual field detection of LMBV, and has the advantages of accurate detection result, good detection sensitivity, short time consumption, no need of depending on professional experimental instruments and laboratory conditions, low requirements on detection equipment and detection personnel, suitableness for basic detection units, farms and the like requiring regular detection of LMBV, and wide application prospect. And early discovery and early prevention of the LMBV are facilitated.

Description

Technical Field

[0001] The present invention belongs to the technical field of virus detection, and more specifically, relates to a kit for detecting largemouth bass iridovirus. Background Art

[0002] Diseases caused by largemouth bass virus (LMBV) infection are one of the main factors restricting the healthy development of largemouth bass aquaculture industry. Symptoms caused by LMBV infection of largemouth bass include lethargy, abnormal swimming, ulcers on the body surface, bleeding and splenomegaly. However, these symptoms are not unique to LMBV infection, and due to geographical differences and other reasons, largemouth bass infected with different LMBV strains often show different clinical symptoms, and it is difficult to diagnose LMBV infection by observing clinical symptoms with the naked eye. At the same time, there is currently no effective antiviral vaccine or therapeutic drug for LMBV. Therefore, accurate detection of LMBV is crucial to prevent LMBV infection.

[0003] In recent years, a variety of methods for specific detection of LMBV have been reported, mainly including PCR-based methods such as real-time quantitative PCR (qRT-PCR), loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), and detection methods based on gene editing Crispr / Cas technology. Overall, although these detection methods have high sensitivity and reliability, they rely on professional instruments, require relatively professional operators, and the detection process is cumbersome, which limits their application in rapid detection at the aquaculture site. Therefore, it is urgent to develop a convenient, rapid and on-site applicable LMBV detection method to provide a guarantee for the healthy development of the largemouth bass aquaculture industry.

[0004] Point-of-Care Testing (POCT) refers to a rapid and easy-to-use test method that is performed at the sampling site rather than in a traditional laboratory. Lateral flow biosensor (LFB), also known as lateral flow test strips, is a representative test method in the field of POCT, with the advantages of short detection time, simple operation, low cost, and easy interpretation of results. LFB has been widely used in many fields, such as disease diagnosis, food safety, and environmental monitoring.

[0005] When assembling LFBs, antibodies are the most commonly used biorecognition elements. In recent years, nucleic acid aptamers, also known as chemical antibodies, have become new biorecognition elements and have been gradually applied to LFBs. Nucleic acid aptamers are single-stranded oligonucleotide sequences (DNA or RNA) that can interact with various types of targets, such as viruses, proteins, cells, and bacteria. As biorecognition elements, nucleic acid aptamers have the advantages of a wide range of targets, easy synthesis, low cost, high stability, strong heat resistance, and long shelf life, which make them very suitable for the development of rapid on-site detection and portable detection devices. For example, there are LFBs that use nucleic acid aptamers instead of antibodies to detect pathogens such as Singapore grouper iridovirus (SGIV), red-spotted grouper nervous necrosis virus (RGNNV), and Mycoplasma hyorhinis. However, nucleic acid aptamers are only part of the on-site rapid detection method. When detecting different viruses, the required nucleic acid aptamers and supporting detection systems are different. That is, when testing different viruses, how to construct a feasible and effective on-site rapid detection method based on nucleic acid aptamers still needs to be explored. Summary of the invention

[0006] Aiming at the deficiency of the existing lack of sensitive and specific on-site rapid detection products for largemouth black bass iridovirus, the invention provides a kit for detecting largemouth black bass iridovirus.

[0007] The first object of the present invention is to provide a kit for detecting largemouth bass iris virus.

[0008] The second object of the present invention is to provide a method for detecting largemouth bass iris virus for non-disease diagnosis and treatment purposes.

[0009] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0010] The present invention uses DNA nucleic acid aptamers that can specifically recognize LMBV virus particles, combines isothermal strand displacement amplification reaction and colloidal gold labeling technology, and constructs a kit for detecting largemouth bass iridovirus. The kit of the present invention can realize rapid on-site visual detection of LMBV, with accurate detection results, good detection sensitivity, short time consumption, and low requirements for detection equipment and detection personnel. Therefore, the present invention requests protection for the kit.

[0011] The invention provides a kit for detecting largemouth bass iris virus, comprising an isothermal strand displacement amplification reaction system and a lateral flow detection test strip.

[0012] Specifically, the reaction system includes a biotin-modified capture aptamer, an amplification aptamer and an SDA primer; the nucleotide sequence of the capture aptamer is shown in SEQ ID NO.1, and its 3' end is modified with biotin; the nucleotide sequence of the amplification aptamer is shown in SEQ ID NO.2; the nucleotide sequence of the SDA primer is shown in SEQ ID NO.3;

[0013] The lateral flow test strip comprises a sample pad, a coupling pad, a nitrocellulose membrane and an absorption pad which are sequentially overlapped on a bottom plate; the coupling pad is coated with a coupling sequence coupled with a marker, and the nucleotide sequence of the coupling sequence is shown in SEQ ID NO.4; a detection line and a quality control line are sequentially arranged on the nitrocellulose membrane; the detection line is coated with a detection line sequence, and the nucleotide sequence of the detection line sequence is shown in SEQ ID NO.5; the quality control line is coated with a quality control line sequence, and the nucleotide sequence of the quality control line sequence is shown in SEQ ID NO.6.

[0014] Specifically, the 5' end of the coupling sequence is modified with a thiol group, and is coupled to the label via the thiol group.

[0015] Optionally, the marker is colloidal gold, latex microspheres, carbon nanoparticles or colloidal silver.

[0016] In a specific embodiment of the present invention, the marker is colloidal gold.

[0017] Specifically, the preparation method of colloidal gold used in the present invention is:

[0018] Heat and stir the chloroauric acid (HAuCl4) solution. After the solution boils, add trisodium citrate solution and continue stirring. When the solution turns wine red, continue heating and stirring. After boiling for 5 minutes, stop heating, stir and cool to room temperature, collect the colloidal gold (AuNPs) solution, centrifuge, concentrate and resuspend in PBS solution.

[0019] More specifically, the chloroauric acid solution was mixed with deionized water in a volume ratio of 1:10000, 200 mL was poured into a round-bottom flask, and the flask was placed on a magnetic stirrer for heating and stirring; after the solution boiled, 4 mL of 1% (m / v) trisodium citrate solution was immediately added and stirred rapidly; when the solution turned into wine red, heating and stirring were continued, and heating was stopped after boiling for 5 minutes, and the solution was cooled to room temperature with stirring, and the AuNPs solution was collected; after centrifugation and concentration, it was resuspended in PBS solution.

[0020] Based on the kit, the present invention also provides a method for detecting largemouth bass iris virus for non-disease diagnosis purposes, comprising the following steps:

[0021] S1. Incubate the sample to be tested with the capture adapter and the amplification adapter described in the kit;

[0022] S2. Add streptavidin-modified magnetic beads and continue incubation to obtain a capture aptamer-sample-amplification aptamer-magnetic bead complex;

[0023] S3. Collect the complex described in S2, use it as a template, and perform SDA reaction using the SDA primer described in the kit to obtain the reaction product ssDNA;

[0024] S4. Add the ssDNA obtained in S3 to the lateral flow test strip described in the kit, and observe the changes in the test line and the quality control line; when the test line and the quality control line are colored, the test result is positive; when the test line does not show color and the quality control line is colored, the test result is negative; when the quality control line does not show color, regardless of whether the test line is colored or not, the test result is judged to be invalid.

[0025] Specifically, if the label coupled to the coupling sequence is colloidal gold, the detection line and the quality control line appear red.

[0026] Specifically, in S1, the usage ratio of the capture aptamer to the amplification aptamer is 0.8-1.2:0.8-1.2.

[0027] More specifically, in S1, the usage ratio of the capture aptamer and the amplification aptamer is 1:1.

[0028] Specifically, in S1, the buffer used for co-incubation is PBS buffer.

[0029] More specifically, in S1, the buffer used for the co-incubation is 1× PBS buffer.

[0030] Specifically, in S1, the co-incubation time is 5 to 30 minutes.

[0031] Preferably, in S1, the co-incubation time is 5 to 10 minutes.

[0032] More preferably, in S1, the co-incubation time is 5 min.

[0033] Specifically, in S2, the incubation time is continued for 20 to 30 minutes.

[0034] Preferably, in S2, the incubation time is continued for 20 minutes.

[0035] Specifically, in S3, the complex described in S2 is collected using a magnetic stand.

[0036] Specifically, in S3, the SDA reaction temperature is 37°C to 50°C.

[0037] Preferably, in S3, the SDA reaction temperature is 50°C.

[0038] Specifically, in S3, the SDA reaction time is 20 to 40 minutes.

[0039] More specifically, in S3, the SDA reaction time is 30 min.

[0040] Specifically, in S4, ssDNA is added to the sample pad of the lateral flow test strip, a flushing buffer is added, and changes in the detection line and the quality control line are observed.

[0041] Specifically, the washing buffer contains 0.6 M NaCl and 0.06 M trisodium citrate.

[0042] The present invention has the following beneficial effects:

[0043] The present invention utilizes DNA nucleic acid aptamers that can specifically recognize LMBV virus particles, combines isothermal strand displacement amplification reaction and colloidal gold labeling technology, and constructs a kit for detecting largemouth bass iridovirus. The kit of the present invention can realize rapid visual on-site detection of LMBV virus particles or LMBV-infected samples, and its detection results are accurate, the detection sensitivity is good, the time consumption is short, and it does not need to rely on professional experimental instruments and laboratory conditions, and the requirements for detection equipment and detection personnel are low. The kit of the present invention is suitable for use by grassroots detection units, farms, etc. that need to regularly detect LMBV, which is conducive to the early detection and early prevention of LMBV. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 It is a colloidal gold solution and a colloidal gold probe coupling complex (a coupling complex of colloidal gold and a coupling sequence) obtained by reducing chloroauric acid with citrate.

[0045] Figure 2 This is a schematic diagram of the structure of the lateral flow test strip prepared by the present invention.

[0046] Figure 3 The present invention provides a process for performing LMBV detection using the kit of the present invention.

[0047] Figure 4 The results are feasibility test results of using the kit of the present invention to detect LMBV.

[0048] Figure 5 The specific detection results of the kit described in the present invention; A in the figure is the detection result of SGIV purified virus, RGNNV enriched tissue sample supernatant and LMBV purified virus; B in the figure is the detection result of SGIV, RGNNV and LMBV infected cell lysates; C in the figure is the detection result of the liver (Liver), spleen (Spleen) and trunk kidney tissue (Trunk kidney) of the infected largemouth black seabass.

[0049] Figure 6 The detection results of the optimization of detection conditions; Figure A is the detection result of SDA reaction temperature optimization; Figure B is the detection result of nucleic acid aptamer incubation time optimization; Figure C is the detection result of SA-magnetic bead incubation time optimization.

[0050] Figure 7 Sensitivity test results of the kit of the present invention; FHM cells were used as the control group. DETAILED DESCRIPTION

[0051] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0052] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0053] The fathead minnow muscle cells (FHM), grouper spleen cells (GS) and grouper brain cells (GB) used in the experiment of the present invention were cultured in Leibovitz's L15 (Gibco) culture medium containing 10% FBS and placed in a 28°C incubator for subculture.

[0054] Largemouth bass virus (LMBV), red-spotted grouper nervous necrosis virus (RGNNV) and Singapore grouper iridovirus (SGIV) were all isolated and preserved by the Aquatic Animal Medicine Laboratory of South China Agricultural University and stored in a -80℃ refrigerator.

[0055] Example 1 A kit for detecting largemouth bass iris virus

[0056] The present invention utilizes DNA aptamers that can specifically recognize LMBV, combines isothermal strand displacement amplification (SDA) and colloidal gold (AuNPs) labeling technology, and constructs a kit for detecting LMBV. The kit mainly includes two parts, namely an isothermal strand displacement amplification reaction system and a lateral flow test strip.

[0057] 1. Isothermal strand displacement amplification reaction system

[0058] On the basis of a DNA nucleic acid aptamer (TTTTGACGCTTTATCCTTTTCTTATGGCGGGATAGTTTCG) that can specifically recognize LMBV virus particles, the present invention obtains an amplification aptamer and an SDA primer that can be used to detect LMBV by adding a specific enzyme recognition site (Nt.BbvCI: GCTGAGG) and an SDA primer binding site (TGGACACG GTGGCTTAGT) at its 3' end. In addition, a capture aptamer is obtained by modifying the 3' end of a DNA nucleic acid aptamer (GCCGGCCCGGGGGA TAGAGTGCTCCCGATCCCTTGGCGAAGGGAC) that can specifically recognize LMBV virus particles with biotin. The amplification aptamer, the capture aptamer and the SDA primer are all DNA sequences, and their nucleotide sequences are shown in Table 1, which are required for an isothermal strand displacement amplification reaction.

[0059] In addition, based on the amplification aptamer, the present invention designs a coupling sequence for coating the coupling pad (the 5' end of which is modified with a thiol group and will be coupled with colloidal gold later), a detection line sequence (T-line) for coating the detection line, and a quality control line sequence (C-line) for coating the quality control line based on the coupling sequence. The coupling sequence, T-line and C-line are all DNA sequences, and their nucleotide sequences are shown in Table 1, which are required for constructing a lateral flow test strip.

[0060] The above DNA sequences of the present invention are specifically shown in Table 1.

[0061] Table 1 DNA sequences used in the present invention

[0062]

[0063] Note: Bio indicates biotin modification at the 3' end, and SH indicates thiol modification at the 5' end.

[0064] 2. Preparation of AuNPs (colloidal gold) and AuNPs-probe coupling complexes

[0065] Preparation of AuNPs: Mix chloroauric acid (HAuCl4) solution purchased from Sigma-Aldrich with deionized water in a volume ratio of 1:10000, take 200 mL and pour it into a round-bottom flask, place it on a magnetic stirrer and heat and stir; after the solution boils, immediately add 4 mL of 1% (m / v) trisodium citrate solution and stir rapidly; when the solution turns wine red, continue heating and stirring, stop heating after boiling for 5 minutes, stir and cool to room temperature, collect AuNPs solution; centrifuge at 12,000×g, 4℃ for 20 minutes, concentrate 6 times, resuspend in 900μL PBS and mix well.

[0066] Preparation of AuNPs-probe coupling complex: add 100 μL coupling sequence (10 μM, shown in SEQ ID NO.4) to the concentrated AuNPs solution, gently blow evenly and shake gently at 4°C for 12 h; add 10% (m / v) BSA solution to block for 3 h, then add 1.5M NaCl and 1% (m / v) sodium dodecyl sulfate to make the final concentrations of 150 mmol / L and 0.01%, respectively, and shake gently at 4°C for 12 h; centrifuge at 12,000×g, 4°C for 20 min, discard the supernatant, add 1 mL washing buffer (containing 20 mM Na3PO4, 5% BSA, 0.25% Tween-20, 10% sucrose) was gently pipetted evenly; centrifuged again at 12,000×g, 4°C for 20 min, and the supernatant was discarded; 1 mL of washing buffer was added and gently pipetted evenly, centrifuged at 12,000×g, 4°C for 20 min, and the supernatant was discarded; the precipitate was resuspended in 100 μL of washing buffer and stored at 4°C in the dark for later use.

[0067] The colloidal gold solution and the colloidal gold probe coupling complex (coupling complex of colloidal gold and coupling sequence) obtained by reducing chloroauric acid with citrate are as follows: Figure 1 As shown. Figure 1 It can be seen that the 1×AuNPs solution is clear, free of impurities, precipitation, and wine red. After the prepared colloidal gold solution was concentrated 6 times, it was coupled with the coupling sequence modified with thiol (AuNPs probe), and after BSA blocking and NaCl aging, the AuNPs-probe coupling complex was obtained. The complex is clear and transparent, the solution is stable, and the color is slightly darker than AuNPs.

[0068] 3. Preparation of Lateral Flow Flow Test Strips (LFB)

[0069] The structural schematic diagram of the lateral flow test strip prepared by the present invention is as follows Figure 2 As shown. Figure 2 It can be seen that the lateral flow test strip consists of a base plate, a sample pad, a coupling pad, a nitrocellulose membrane and an absorption pad.

[0070] The preparation method of the lateral flow test strip is as follows:

[0071] The glass fiber was fully soaked in the sample pad buffer and then stored in a dry environment at room temperature. Then the sample pad, coupling pad, nitrocellulose membrane and absorption pad were sequentially pasted on the bottom plate, and the overlapping width between the two adjacent parts was 1.5 mm. The synthesized test line sequence (T-line, 100 μM, 40 μL) and quality control line sequence (C-line, 100 μM, 40 μL) were drawn on the nitrocellulose membrane with a spray volume of 0.5-0.8 mL / cm by a three-dimensional reciprocating gold-marked film scribing instrument (the distance between the two probes was 7 mm), and the test area and quality control area were obtained respectively. Finally, the assembled test strip was placed in a test strip cutting machine and cut according to the size of 6 cm in length and 3.5 mm in width. The test strip was stored in dry conditions at room temperature.

[0072] Example 2 Detection of Largemouth Bass Iridescent Virus

[0073] Based on the kit described in Example 1, the present invention also provides a method for detecting LMBV to achieve monitoring of LMBV.

[0074] 1. Preparation of LMBV-infected Cells and Largemouth Bass Samples

[0075] FHM cells at 25 cm 2 The cells were subcultured in cell culture flasks (Corning), cultured in a constant temperature incubator at 28°C for 18 h, and then LMBV (MOI = 0.5, 4 μL) was added for infection; the cytopathic effect caused by virus infection was observed under an optical microscope at 96 hpi; the virus-infected cell suspension was collected, centrifuged at 900 × g for 10 min, and the supernatant was discarded; 1 mL of serum-free medium was added for resuspending, centrifuged at 900 × g for 2 min, the supernatant was discarded, 100 μL of IP Lysis Buffer (Thermo Fisher Scientific) was added to lyse the cells on ice for 30 min, and stored in a -80°C refrigerator for use.

[0076] Healthy largemouth bass (8-10 cm) were collected for LMBV challenge experiments, cultured in a circulating water system at 28±1°C, and fed twice a day for 10 consecutive days. Largemouth bass were randomly selected for virus testing before challenge to ensure that they were LMBV negative. 100 μL LMBV (10 4.7 TCID 50 / mL) were used to infect largemouth bass; on the 4th day after virus infection, the dying largemouth bass were dissected, and their liver, spleen and kidney tissues were taken out, washed with PBS and cut into small pieces, and lysed by adding 300μL IP LysisBuffer for 10min; filtered with medical gauze, the filtrate was briefly centrifuged, and the supernatant was collected for detection.

[0077] 2. Detection of LMBV

[0078] The process of LMBV detection using the kit described in Example 1 of the present invention is as follows: Figure 3 As shown. During the detection, the capture aptamer (10 μM) and the amplification aptamer (10 μM) were first incubated with the sample to be tested (if it is a tissue block, take a mung bean-sized amount, the same as the amount used for nucleic acid extraction; if it is a cell sample, take 200 μL of cell sample) in 100 μL PBS (1×PBS buffer) (room temperature (25°C)) for 1 hour; PBS was used as a negative control; then 1.5 μL SA (streptavidin) modified magnetic beads were added, and the mixture was shaken in a 4°C constant temperature metal bath for 30 minutes to obtain "capture aptamer-LMBV-amplification aptamer-SA-magnetic beads"; 1 mL PBST (1×PBST buffer) was added to the "capture aptamer-LMBV-amplification aptamer-SA-magnetic beads", and the mixture was gently blown evenly; the magnetic bead complex was collected under the action of a magnetic separator, and 10 μL Resuspend in ddH2O and use it as a template for SDA reaction (SDA reaction system is shown in Table 2, and SDA reaction is carried out at 37°C for 30 min); add the reaction product ssDNA dropwise to the prepared LFB sample pad, add 50 μL of washing buffer (0.6 M NaCl, 0.06 M trisodium citrate), and observe the results within 5 min.

[0079] Table 2 SDA reaction system

[0080]

[0081]

[0082] When DNA polymerase is present, the SDA primer binds to the primer binding site on the amplification adapter to initiate amplification, and the formed complementary chain is cut at the Nt.BbvCI restriction site, and then the extension reaction continues at the cut site. The above process is repeated continuously to produce a large amount of amplified ssDNA.

[0083] 3. Feasibility test

[0084] Based on the above method, the present invention tests the feasibility of using the kit to detect LMBV.

[0085] The experiment was designed as follows: experimental group, LMBV purified virus (MOI=10, 2μL) was incubated with amplification aptamer and capture aptamer; control group 1, LMBV purified virus (MOI=10, 2μL) was incubated with capture aptamer; control group 2, LMBV purified virus (MOI=10, 2μL) was incubated with amplification aptamer; control group 3, an equal amount of PBS was incubated with amplification aptamer and capture aptamer.

[0086] The feasibility test results of using the kit of the present invention to detect LMBV are as follows Figure 4 As shown. Figure 4 It can be seen that only when LMBV, the amplification aptamer and the capture aptamer coexist, can the detection line (T line) and the quality control line (C line) simultaneously show red, indicating that the sample to be tested contains LMBV, while no T line is colored in the three control groups. The above results show that the kit of the present invention can effectively detect LMBV.

[0087] The detection principle is as follows:

[0088] The capture aptamer of the present invention is modified with biotin, which can be non-covalently coupled with SA-modified magnetic beads, so that the captured LMBV is enriched on the magnetic beads; the amplification aptamer has a modified enzyme cleavage site, and its presence is a necessary condition for the SDA reaction; only when the above three exist at the same time can a "capture aptamer-LMBV-amplification aptamer-SA-coated magnetic beads" complex be formed, and the ssDNA product can be amplified by the SDA reaction. ssDNA is complementary to the detection line sequence, and AuNPs-probe is also complementary to ssDNA. Therefore, when a large amount of ssDNA is dripped onto the sample pad of LFB, a red strip can be formed in the T line area. In addition, the AuNPs-probe sequence is also complementary to the quality control line sequence. Under the action of capillary force, the excess AuNPs-probe coupling complex continues to migrate, and a color reaction occurs in the C line area. When LMBV is missing, the "capture aptamer-LMBV-amplification aptamer-SA-coated magnetic beads" complex cannot be formed; when the amplification aptamer is missing or the capture aptamer cannot perform the SDA reaction or the target cannot be enriched by the magnetic beads. Therefore, only when LMBV and two nucleic acid aptamers exist at the same time can the detection line be colored.

[0089] Specifically, when both the test line and the quality control line are red, the test result is positive; when the test line does not show color and the quality control line is red, the test result is negative; when the quality control line does not show color, regardless of whether the test line shows red or not, the test result is judged to be invalid.

[0090] Example 3 Specificity Detection

[0091] 1. Preparation of cell samples infected with LMBV, RGNNV or SGIV

[0092] The preparation of virus-infected cell samples is the same as in Example 2, except that the viruses used include RGNNV and SGIV in addition to LMBV, and the cells are infected with the viruses respectively.

[0093] 2. Preparation of LMBV-infected Largemouth Bass Samples

[0094] The preparation of virus-infected largemouth bass body samples was the same as in Example 2.

[0095] The kit of the present invention was used to detect SGIV purified virus, RGNNV enriched tissue sample supernatant and LMBV purified virus, cell lysates infected with SGIV, RGNNV and LMBV, and liver, spleen and kidney tissues of largemouth bass infected with LMBV, respectively, to detect the detection specificity of the kit.

[0096] The specific detection results of the kit of the present invention are as follows Figure 5 As shown; Figure 5 A in the figure is the test result of SGIV purified virus, RGNNV enriched tissue sample supernatant and LMBV purified virus; Figure 5 B in the figure shows the detection results of cell lysates infected with SGIV, RGNNV and LMBV; Figure 5 C in the figure is the test result of liver, spleen and trunk kidney of largemouth bass infected with LMBV. Figure 5 It can be seen that the LFB of the LMBV group samples showed a clearly visible detection line; while the LFB of the SGIV and RGNNV group samples only had one C line colored, and the T line was not colored. Similarly, only the FHM cells infected with LMBV were detected with positive bands, while the FHM cells infected with SGIV and RGNNV did not have positive bands. The liver, spleen and kidney tissues of largemouth bass artificially infected with LMBV were tested, and LFB was able to detect positive bands ( Figure 5 C in the figure). The above results indicate that the kit of the present invention has specificity for detecting LMBV and can effectively detect LMBV virus particles, LMBV-infected cells and tissue samples.

[0097] Example 4 Optimization of detection system

[0098] In order to further improve the detection performance of the kit, the present invention optimizes the detection system.

[0099] 8×10 7 FHM cells infected with LMBV / mL were used as the test sample, and uninfected FHM cells were used as the control. First, the effect of different SDA reaction temperatures on the test results was detected, and the reaction temperatures were set to 25°C, 37°C, 42°C, 50°C and 65°C (the rest of the operations were the same as in Example 2) to obtain the best SDA reaction temperature. The SDA reaction temperature optimization test results are shown in FIG. Figure 6As shown in A in the figure. As can be seen from the figure, under the conditions of 25℃ and 65℃, the SDA reaction cannot proceed normally, and only one quality control line appears in LFB without a detection line. At 37℃, 42℃ and 50℃, the SDA reaction can proceed normally, among which the LFB detection line band of the 50℃ group is obviously darker than that of the other two groups, indicating that the SDA reaction has a higher amplification efficiency under this condition.

[0100] Subsequently, the incubation time of the test sample with the nucleic acid aptamer and the next step with the SA-modified magnetic beads in the detection process were optimized, and the incubation time gradient was set to 2 min, 5 min, 10 min, 20 min and 30 min.

[0101] The results of the optimized incubation time of aptamers are as follows Figure 6 As shown in B in FIG. 1 , when the incubation time between the sample to be tested and the capture aptamer is reduced to 2 min, LFB can still detect the positive band, but the color is weaker. Under the incubation time condition of 5 to 30 min, the color of the positive band is almost the same. The optimal incubation time for this step is 5 min.

[0102] The results of the SA-magnetic bead incubation time optimization test were as follows Figure 6 As shown in C in Figure 1, positive bands appeared at all time gradients. However, when the time was less than 20 min, the color of the positive bands was significantly weakened. Therefore, the optimal incubation time for this step was 20 min.

[0103] The above results show that the optimal reaction temperature for LFB detection of LMBV is 50°C, and the entire LFB detection process can be completed within 1 hour.

[0104] Example 5 Sensitivity Detection

[0105] After optimizing the detection conditions, the present invention further analyzed the detection sensitivity of the kit of the present invention using the optimized detection conditions. Referring to the method for infecting cells described in Example 2, the preparation of LMBV-infected cells and largemouth black bass body samples, LMBV-infected FHM cells were obtained. By cell counting method, the following concentrations of LMBV-infected FHM cells were prepared: 8×10 7 , 8×10 6 , 8×10 5 , 8×10 4 , 8×10 3 , 8×10 2 and 8×10 1 / mL, and uninfected FHM cells were used as the control group. The sensitivity test results are shown in Figure 7 As shown, the control group did not show the detection line, while 8×10 1The detection line of the group with a fainter color appeared in the group with a fainter color. Therefore, the lower detection limit of LFB observed by naked eyes is 8×10 1 / mL LMBV-infected FHM cells.

[0106] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A kit for detecting largemouth bass iris virus, characterized in that: It includes an isothermal strand displacement amplification reaction system and a lateral flow test strip; The reaction system includes a biotin-modified capture aptamer, an amplification aptamer and an SDA primer; the nucleotide sequence of the capture aptamer is shown in SEQ ID NO.1, and its 3' end is modified with biotin; the nucleotide sequence of the amplification aptamer is shown in SEQ ID NO.2; the nucleotide sequence of the SDA primer is shown in SEQ ID NO.3; The lateral flow test strip comprises a sample pad, a coupling pad, a nitrocellulose membrane and an absorption pad which are sequentially overlapped on a bottom plate; the coupling pad is coated with a coupling sequence coupled with a marker, and the nucleotide sequence of the coupling sequence is shown in SEQ ID NO.4; a detection line and a quality control line are sequentially arranged on the nitrocellulose membrane; the detection line is coated with a detection line sequence, and the nucleotide sequence of the detection line sequence is shown in SEQ ID NO.5; the quality control line is coated with a quality control line sequence, and the nucleotide sequence of the quality control line sequence is shown in SEQ ID NO.

6.

2. The kit according to claim 1, characterized in that The 5' end of the coupling sequence is modified with a thiol group.

3. The kit according to claim 2, characterized in that The marker is colloidal gold, latex microspheres, carbon nanoparticles or colloidal silver.

4. A method for detecting iridovirus in largemouth bass for non-disease diagnosis purposes, characterized in that: The following steps are involved: S1. Incubating the sample to be tested with the capture aptamer and the amplification aptamer described in claim 1; S2. Add streptavidin-modified magnetic beads and continue incubation to obtain a capture aptamer-sample-amplification aptamer-magnetic bead complex; S3. collecting the complex described in S2, using it as a template, and performing an SDA reaction using the SDA primer described in claim 1 to obtain a reaction product ssDNA; S4. Add the ssDNA obtained in S3 to the lateral flow test strip described in claim 1, and observe the changes in the test line and the quality control line; when both the test line and the quality control line are colored, the test result is positive; when the test line does not show color and the quality control line is colored, the test result is negative; when the quality control line does not show color, regardless of whether the test line is colored or not, the test result is judged to be invalid.

5. The method according to claim 4, characterized in that: In S1, the usage ratio of the capture aptamer to the amplification aptamer is 0.8-1.2:0.8-1.

2.

6. The method according to claim 4, characterized in that: In S1, the buffer used for the co-incubation is PBS buffer.

7. The method according to claim 4, characterized in that: In S1, the co-incubation time is 5 to 30 minutes.

8. The method according to claim 4, characterized in that: In S2, the incubation time is continued for 20 to 30 minutes.

9. The method according to claim 4, characterized in that: In S3, the SDA reaction temperature is 37°C to 50°C.

10. The method according to claim 4, characterized in that: In S3, the SDA reaction time is 20 to 40 minutes.

Images