Molecular marker for brassica napus drought resistance identification and genetic improvement and application thereof

Abstract

The invention discloses a molecular marker for brassica napus drought resistance identification and genetic improvement. A gene BnaA10. LEA4-5 for coding an embryo late abundance protein is proved to be capable of improving the drought resistance of the brassica napus. According to the invention, molecular markers corresponding to haplotypes with different functions of the gene and primers thereof are designed by utilizing re-sequencing data. The DNA molecular marker can distinguish the functional haplotype of the gene of a to-be-detected brassica napus line, can be used for molecular marker-assisted breeding of brassica napus drought resistance and drought resistance genetic improvement of a non-drought-resistant haplotype, and is simple, rapid and high in accuracy; and a powerful technical support is provided for breeding and genetic improvement of a new drought-resistant variety of brassica napus.

Description

Technical Field

[0001] The invention belongs to the technical field of rapeseed breeding, and in particular relates to a molecular marker used for drought resistance identification and genetic improvement of Brassica napus. Background Art

[0002] The continuous increase in the global population has led to an increasingly serious shortage of grain and oil. At present, my country's vegetable oil self-sufficiency rate is only one-third. Brassica napus is my country's largest oil crop, and its output accounts for more than half of the output of all oil crops. In addition, rapeseed has multiple values ​​such as feed, vegetable and tourism, and is also an important economic crop. The cultivation of rapeseed has the advantage of not competing with staple food for land. Therefore, increasing the planting area and production capacity of rapeseed is of great significance to the country's edible oil safety.

[0003] Brassica napus is mainly grown in the Yangtze River Basin and Northwest my country. The growth of rapeseed in these two regions is easily affected by seasonal drought and long-term drought. In 2022, the middle and lower reaches of the Yangtze River suffered from rare consecutive droughts in summer, autumn and winter, and rapeseed production dropped significantly. Therefore, breeding drought-resistant rapeseed varieties and improving rapeseed's resistance to drought stress are the basis for maintaining and increasing rapeseed planting area and yield. When Brassica napus encounters drought stress in the seedling stage, it causes seedling water loss and leaf wilting, which inhibits the normal growth of rapeseed and even causes plant death.

[0004] Most of the water in plant seedlings is lost through stomata, and a small part of it is lost through transpiration of the cuticle on the leaf surface. Therefore, identifying important drought resistance QTLs in Brassica napus through stomatal traits, screening and verifying drought resistance functional genes, and developing corresponding molecular markers can be used for molecular marker-assisted breeding, which is of great significance for improving the drought resistance and yield of Brassica napus, expanding the planting area, and increasing the self-sufficiency rate of vegetable oil. Summary of the invention

[0005] The purpose of the present invention is to provide a class of molecular markers for identification of drought resistance and genetic improvement of Brassica napus and their application.

[0006] To achieve the above objectives, we first used a natural population of Brassica napus containing 167 germplasm resources to analyze the stomatal conductance traits under mild drought conditions (50% relative soil moisture content) and combined with genome-wide association analysis technology to successfully locate a gene encoding a protein abundant in the late embryo on chromosome BnaChrA10. BnaA10.LEA4-5 , which was shown to positively regulate the drought resistance of Brassica napus. Then, specific molecular markers and primers were developed through its different functional haplotypes, which can be used to identify the drought resistance of Brassica napus and genetic improvement of non-drought-resistant haplotype materials.

[0007] The molecular marker primers designed by the present invention have four pairs, namely YX1, YX2, YX3, and YX4, and the nucleotide sequences are as follows: YX1 forward primer: GACCTGAGAATGAGTCTATTAC (SEQ ID NO.1) YX1 reverse primer: TCTTGTCCATGCCAGACTTG (SEQ ID NO.2) YX2 forward primer: ACACGTCTCGCTTACGTGTT (SEQ ID NO. 3) YX2 reverse primer: TCGGTGAGCATGTCCCATTA (SEQ ID NO. 4) YX3 forward primer: GATGTGACCATCAGGTCTCT (SEQ ID NO. 5) YX3 reverse primer: GCTCATCATCACCGATTCTAC (SEQ ID NO.6) YX4 forward primer: TCACCGAGCAAAGCATCGAA (SEQ ID NO.7) YX4 reverse primer: TGAAGCTGTTTCCTTCATCG (SEQ ID NO.8) Among them, the length of the amplified fragment of the YX1 forward and reverse primers is 920-931bp, including the variation sites of 5 haplotypes. Through a Sanger sequencing of the amplified products, the 5 haplotypes of rapeseed can be distinguished, and then whether it belongs to the drought-resistant variety can be determined. The length of the amplified fragment of the YX2 forward and reverse primers is 122-127 bp, the length of the amplified fragment of the YX3 forward and reverse primers is 99-101 bp, and the length of the amplified fragment of the YX4 forward and reverse primers is 123-130 bp. The combination of these three pairs of primers can achieve genetic improvement of non-drought-resistant haplotype background materials.

[0008] The invention also provides the application of the molecular marker in the identification of drought resistance and genetic improvement of Brassica napus.

[0009] The present invention also provides a method for identifying drought resistance and genetic improvement of Brassica napus, the method comprising the following steps: Step 1: Extract DNA from the plant to be tested; Step 2: Using the DNA obtained in step 1 as a template and the above-mentioned molecular marker YX1 as a primer, PCR amplification is performed; Step 3: Detect the PCR amplification product.

[0010] Furthermore, the reaction system for PCR amplification in step 2 was 10 μL, including: 5 μL Vazyme 2×Taq Plus Master Mix, 0.25 μL forward primer, 0.25 μL reverse primer, 2 μL DNA template, 2.5 μL ddH 2 O.

[0011] Furthermore, the reaction procedure of PCR amplification in step 2 is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 15 s, extension at 72°C for 30 s, 35 cycles; and finally extension at 72°C for 10 min.

[0012] Compared with the prior art, the present invention has the following beneficial effects: the present invention locates and screens candidate genes through genome-wide association analysis BnaA10.LEA4-5 The functional research results show that this gene positively regulates the drought resistance of Brassica napus. Based on the drought-resistant functional gene, haplotype analysis was carried out and corresponding molecular markers were designed. The molecular marker can specifically amplify the functional gene or its haplotype, thereby judging the drought resistance of the tested plant and achieving drought-resistant genetic improvement of the corresponding material of the non-drought-resistant haplotype. This method is simple, fast, accurate and reproducible. Combining this molecular marker with field selection can quickly identify and select drought-resistant Brassica napus varieties, which will help advance the process of drought-resistant breeding of Brassica napus. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The phenotypic data of stomatal conductance traits of a natural population of Brassica napus containing 167 lines under normal conditions and mild drought conditions are used. A is a box plot of stomatal conductance traits; B is a frequency distribution histogram of stomatal conductance traits; Figure 2 A is the Manhattan plot and QQ plot of genome-wide association analysis of stomatal conductance traits under mild drought conditions; B is the expression of genes in the QTL interval of chromosome A10 in response to abiotic stress and BnaA10.LEA4-5 Screening; C is the candidate gene BnaA10.LEA4-5 Variation analysis of the gene region and its upstream 1 kb; D is based on candidate genes BnaA10.LEA4-5 Haplotype analysis of variants and correspondence with phenotypes.

[0014] Figure 3 Candidate genes BnaA10.LEA4-5 A is the use of CRISPR to create a rapeseed mutant; B is the real-time fluorescence quantitative PCR verification of the overexpression strain; C is the protein immunoblotting experiment verification of the overexpression strain; D is the drought resistance function verification of the created rapeseed material.

[0015] Figure 4 In the present invention, YX1 primers were used in combination with Sanger sequencing to divide functional haplotypes.

[0016] Figure 5 In the present invention, primers YX2, YX3 and YX4 are used to perform molecular marker detection on the plants to be tested. DETAILED DESCRIPTION

[0017] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solution of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0018] Example 1 Brassica napus BnaA10.LEA4-5 Gene localization, cloning and verification.

[0019] Mild drought stress treatment and phenotypic determination of natural populations of Brassica napus (1) On October 1, 2016, 167 core accessions of Brassica napus were planted in pots at the potting farm of Huazhong Agricultural University. The experiment was divided into a control group (WW, soil relative moisture content of about 80%) and a drought group (WS, soil relative moisture content of 50%), with 4 replicates for each treatment.

[0020] (2) Each group of core germplasm materials of Brassica napus was planted in 4 pots. Each pot was filled with 3 kg of soil sample, of which the ratio of soil to sand was 2:1. Each pot contained 0.65 g of urea, 1.5 g of phosphorus fertilizer, and 0.35 g of potassium fertilizer. Five self-pollinated seeds were sown in each pot, and uniform seedlings were selected and transplanted to one plant per pot when the rapeseed grew to the two-leaf and one-heart stage.

[0021] (3) Watering was carried out normally in the early stage, and drought treatment was started when the rapeseed had grown to 4-5 true leaves. During the drought treatment, the control group was watered normally, and the soil relative water content (SRWC) of the potted plants was controlled at about 80% by weighing method; the treatment group was not watered, and the soil relative water content (SRWC) of the potted plants was controlled at 50% by weighing method.

[0022] (4) The water content was calculated as follows. The test soil was dried in an oven at 70°C for 36 h and placed in a pot with holes at the bottom and lined with filter paper (W0), which was weighed (W1). Water was then poured until water flowed out from the bottom and the soil was left overnight and weighed (W2). This was repeated four times to calculate the field water holding capacity. During the drought stress period, the potted plants were weighed every day (W3) to calculate the relative water content of the soil.

[0023] (5) A Li-Cor 6800 portable photosynthetic system (Li-Cor Bioscience) equipped with a red / blue (9:1) light source (Li-Cor Part No. 6800-2B, area 6 cm 2 ), and the photosynthetic parameters were measured on fully expanded new leaves of appropriate size. The measurement time was 8:30-16:30 on a clear day, and the main photosynthetic parameter was the leaf chamber flow rate of 500 µmol s -1 ; Relative moisture content 50%-80%; High-pressure carbon dioxide cylinder maintains a carbon dioxide flow rate of 400 µmol s -1 ; fan speed 10000 rpm; rapeseed leaf temperature 25°C; leaf chamber light intensity 1200 µmol m −2 s −1 . Save the data after the photosynthetic parameters are stable and no longer change significantly.

[0024] (6) The experimental results of stomatal conductance of the group under mild drought conditions are shown in Table 1. The statistical group data are as follows Figure 1 shown.

[0025] Table 1. Stomatal conductance values ​​of 167 Brassica napus samples under mild drought conditions

[0026] Example 2 Candidate genes BnaA10.LEA4-5 Positioning (1) Our laboratory performed genome resequencing on a collection of 505 Brassica napus accessions for association analysis (Tang et al. 2021) and obtained high-quality sequencing data using the BWA (v0.75) software (Heng et al. 2009).

[0027] (2) Using the Darmor-bzh v4.1 genome (http: / / www.Genoscope.cns.fr / brassicanapus / data / ) as the reference genome for this experiment, variation analysis was performed on 167 of the 505 Brassica napus genome resequencing results used in the present invention, and 8,535,594 high-quality SNP and InDel markers were screened.

[0028] (3) In the genome-wide association analysis, the GEMMA software model was used to adopt the linear mixed model method. 8,535,594 high-quality SNP and InDel markers were used, combined with phenotypic values ​​(i.e., stomatal conductance after mild drought treatment) and the 1.0e -06 As the significance threshold, QTL loci related to drought resistance were identified on a genome-wide scale. Figure 2 As shown in A.

[0029] (4) A major drought resistance QTL locus was identified on chromosome A10 of Brassica napus, located between bp 15665693 and bp 15954314 of chromosome A10. Figure 2 As shown in A.

[0030] (5) Among the QTL sites, combined with transcriptome data, genes were found BnaA10.LEA4-5 (BnaA10g24180D) is more easily induced by a variety of abiotic stresses than other genes in the interval. Therefore, this gene was identified as a candidate gene. Figure 2 As shown in B.

[0031] Example 3 Functional verification of candidate genes In order to verify the function of the candidate gene, a high-fidelity polymerase was used to amplify the BnaA10.LEA4-5 The gene region coding sequence was obtained, the amplified fragment was recovered and double-digested, then cloned into the plant expression vector pMDC83, transformed into Escherichia coli DH5α, single clones were picked for detection and sequencing, and the plant recombinant expression vector containing the candidate gene was successfully obtained. BnaA10.LEA4-5 The coding sequence of the gene region is as follows (the underlined part is the reverse complementary sequence of the F primer and the R primer of the coding region): ATGCAGTCGATGAAGGAAACAGCTTCAAACATCGCAGCTTCTGCCAAGTCTGGCATGGACAAGACCAAAGCCACCTTGGAGGAGAAGGCTGAGAAGATGACAACAAGAGACCCTCTTCAGAAAGAGATGGCTACACAGAAGAAAGAAGGGAGGATCAATGAGGCTGAGATGCAGAAGAGAGAAGCGCGCGAGCACAACGCTGTCATGAAAGAAGCCAGTGGAGCTGGAACTGGAACCGG TTTGGGAATGGGAACCGCCACTCACTCGACCACTGGACACGTTGGACACGGAACTGGGACCCATCAGATGTCGGCTTTGCCTGGTCACGGCACGGGACAACCAGCGGGCCACGTTGTGGATGGTACAGCCGTGACAGAACCGATAGGAACGAACACTGGAACTGGTAGGACCACCGCTCATAACACCCGCGTTGGTGGTGGCACCACTGGGTATGGAA CCGGTGGAGGATATACTGGATAA (SEQ ID NO.9) The correct recombinant plasmid was introduced into the Agrobacterium strain GV3101, and the conventional rapeseed genetic transformation method was used to transform the recombinant plasmid into the Brassica napus receptor material westar and culture the seedlings. The obtained seedlings were tested by real-time fluorescence quantitative PCR and protein immunoprecipitation experiments to ensure that positive plants were obtained (see attached). Figure 3 B, C). Similarly, CRISPR-Cas9 technology was used to construct a mutant of Brassica napus (see Appendix Figure 3 A). After multiple generations of testing, homozygous overexpression and mutant plants were obtained for functional verification.

[0032] The transgenic T2 generation was subjected to drought tests to verify the function of the introduced candidate gene. The results are shown in the attached Figure 3 As shown in D, after drought treatment, the overexpressing plants showed higher drought resistance while the mutants showed reduced drought resistance. This proves that this gene is a functional drought resistance gene of Brassica napus. Figure 2 As shown in C, 10 synonymous mutations in the gene region of the gene and 13 mutations in the upstream 1 kb, a total of 23 mutations were used for haplotype analysis, and a total of 5 haplotypes were obtained. Combined with the phenotypic analysis, it was found that hap1, hap2, and hap3 were drought-resistant haplotypes, corresponding to low stomatal conductance; while hap4 and hap5 were drought-sensitive haplotypes, corresponding to higher stomatal conductance. There was a significant level difference between the two different haplotypes, as shown in the following figure. Figure 2 As shown in D.

[0033] Example 4 Development of molecular markers based on haplotypes of drought-resistant functional genes This example designs and develops related molecular markers based on the sequences of the drought-resistant functional genes and haplotypes of Brassica napus obtained by verification in Example 3. The primer nucleotide sequences of the molecular markers are as follows: Hap1 TTGATCAAAAGTTCAAAACTGAAACTTGGTTGCTTTTATTGGATGATGCAGGAACATGAACAAGCGCTTGTTTCTGCCATTGCAAGGCTTGCGGATGCTTCTGATTTCGAAAGCGGTAAGAAACATGAGTCTTTGTATAT GACCTG AGAATGAGTCTATTAC CTAATTTAAATCACATTGTTTGTCTGAACGACTCAATATATTTGTTTCATTCCAAGACCAGTGATGTTATGTTTTTATCTTTGGCTTTTGTGTGTTGCTGCTGAATCAGATGGAGAAGAGGCGTATATGCATGAGCTTCCAATGCATGAGGGATAGCAGTGGATAAAGAAAAG ATATTCGCCCATCAAACTAAGCACACTCTTCTTATCCTTTGGACATGTAAACAAACCGGAGAAGTTTCTGCGAAGATGAAAACATTATGTATTGATTTCAAAATGTATTAAAATAATCCTTAGGAATTTTGTTTGTAAAACACATTAATTCTTTTTCAAATTTATTAATTATT GATGTGACCATCAGGTCTCT AGTCATCAAAGATTTGGCGTTATGCTTTACCGTGTGGTTATCGTTAAATTTGCAACATGT GTAGAATCGGTGATGATGAG C GGGCCAAAAGCCTAATGGTGTAGTTAGAGTTTTGGTGATAATGATATGCACGGCGGACGTAAAAAACAACATAACTAACTCTTTCCACCACTAACCAAAGCCTAACACGCGTCGACATGCGAACTGCTTTACGGCTCTACCGCTACGTACACGTGCATGATAAAGAGATGCAACACAAAGCCTACCACCTCTTGGTTCGTG ACACGTCTCGCTTACGTGTTGCCAAAGAGCGTAATTAAATAATAATCACAGTTACCGACTATAGTAACACGTGGGTTTGGCATTGTCTATATAT TAATGGGACATG CTCACCGAGCAAAGCATCGAA CAAAAAAACACGAAGAATCATAAGCTATATTTTTGTAACATCTTTGAATACTAAGCAGGAAAAAATGCAGT CGATGAAGGAAACAGCTTCA AACATCGCAGCTTCTGC CAAGTCTGGCATGGACAAGA Hap2 TTGATCAAAAGTTCAAAACTGAAACTTGGTTGCTTTTATTGGATGATGCAGGAACATGAACAAGCGCTTGTTTCTGCCATTGCAAGGCTTGCGGATGCTTCTGATTTCGAAAGCGGTAAGAAACATGAGTCTTTGTATAT GACCTG AGAATGAGTCTATTAC CTAATTTAAATCACATTGTTTGTCTGAACGACTCAATATATTTGTTTCATTCCAAGACCAGTGATGTTATGTTTTTATCTTTGGCTTTTGTGTGTTGCTGCTGAATCAGATGGAGAAGAGGCGTATATGCATGAGCTTCCAATGCATGAGGGATAGCAGTGGATAAAGAAAAGATATTCGCCCATCAAACTAAGCACACTCTTCTTATCCTTTGGACATGTAAACAAACCGGAGAAGTTTCTGCGAAGATGAAAACATTATGTATTGATTTCAAAATGTATTAAAATAATCCTTAGGAATTTTGTTTGTAAAACACATTAATTCTTTTTCAAATTTATTAATTATT GATGTGACCATCAGGTCTCT AGCCATCAAAGATTTGGCGTTATGCTTTACTGTGGTTATTGTTAAATTTGCAACATGT GTAGAATCGGTGATGATGAGC GGGCCAAAAGCCTAATGGTGTAGTTAGAGTTTTGGTGATAATGATATGCACGGCGGACGTAAAAAACAACATAACTAACTCTTTCCACCACTAACCAAAGCCTAACACGCGTCGACATGCGAACTGCTTTACGGCTCTACCGCTACGTACACGTGCATGATAAAGAGATGCAACACAAAGCCTACCACCTCTTGGTTCGTG ACACGTCTCGCTTACGTGTT GCCAAAGAGCGTAAAATAATAATCACAGTTACCGACTATAGTAACACGTGGGTTTGGCATTGTCTATAT TAATGGGACATGCTCACCG AGCAAAGCATCGAACAAAAAAACACGAAGAATCATAAGCTATATTTTTGTAACATCTTTGAATATTACTAAGCAGGAAAAATGCAGT CGATGAAGGAAACAGCTTCA AACATCGCAGCTTCTGC CAAGTCTGGCATGGACAAGA Hap3 TTGATCAAAAGTTCAAAACTGAAACTTGGTTGCTTTTATTGGATGATGCAGGAACATGAACAAGCGCTTGTTTCTGCCATTGCAAGGCTTGCGGATGCTTCTGATTTCGAAAGCGGTAAGAAACATGAGTCTTTGTATAT GACCTG AGAATGAGTCTATTAC CTAATTTAAATCACATTGTTTGTCTGAACGACTCAATATATTTGTTTCATTCCAAGACCAGTGATGTTATGTTTTTATCTTTGGCTTTTGTGTGTTGCTGCTGAATCAGATGGAGAAGAGGCGTATATGCATGAGCTTCCAATGCATGAGGGATAGCAGTGGATAAAGAAAGAGATTCGCCCATCAAACTAAGCGCACTCTTCTTATCCTTGGACATGTAAACAAACCGGAGAAGTTTCTGCGAAGATGAAAACATTATGTATTGATTTCAAAATGTATTAAAATAATCCTTAGGAATTTTGTTTGTAAAACACATTAATTCTTTTTCAAATTTATTAATTATT GATGTGACCATCAGGTCTCT AGCCATCAAAGATTTGGCGTTATGCTTTACTGTGGTTATTGTTAAATTTGCAACATGT GTAGAATCGGTGATGATGAGC GGGCCAAAAGCCTAATGGTGTAGTTAGAGTTTTGGTGATAATGATATGCACGGCGGACGTAAAAAACAACATAACTAACTCTTTCCACCACTAACCAAATCCTAACACGCGTCGACATGCGAACTGCTTTACGGCTCTACCGCTACGTACACGTGCATGATAAAGAGATGCAACACAAAGCCTACCACCTCTTGGTTCGTG ACACGTCTCGCTTACGTGTT GCCAAAGAGCGTAATTAAATAATAATCACAGTTACCGACTATAGTAACACGTGGGTTTGGCATTGTCTATATAT TAATGGGACATGCTC ACCGAGCAAAGCATCGAACAAAAAAACACGAAGAATCATAAGCTATATTTTTGTAACATCTTTGAATATTACTAAGCAGGAAAAATGCAGT CGATGAAGGAAACAGCTTCA AACATCGCAGCTTCTGC CAAGTCTGGCATGGACAAGA Hap4 TTGATCAAAAGTTCAAAACTGAAACTTGGTTGCTTTTATTGGATGATGCAGGAACATGAACAAGCGCTTGTTTCTGCCATTGCAAGGCTTGCGGATGCTTCTGATTTCGAAAGCGGTAAGAAACATGAGTCTTTGTATAT GACCTG AGAATGAGTCTATTAC CTAATTTAAATCACATTGTTTGTCTGAACGACTCAATATATTTGTTTCATTCCAAGACCAGTGATGTTATGTTTTTATCTTTGGCTTTTGTGTGTTGCTGCTGAATCAGATGGAGAAGAGGCGTATATGCATGAGCTTCCAATGCATGAGGGATAGCAGTGGATAAAGAAAGAGATTCGCCCATCAAACTAAGCGCACTCTTCTTATCCTTGGACATGTAAACAAACCGGAGAAGTACTTTCTGCGAAGATGAAAACATTATGTATTGATTTCAAAATGTATTAAAATAATCCTTAGGAATTTTGTTTGTAAAACACATTAATTCTTTTTCAAATTTATTAATTATT GATGTGACCATCAGGTCTCT AGCCATCAAAGATTTGGCGTTATGCTTTACCGTGTGGTTATCGTTAAATTTGCAACATGT GTAGAATCGGTGATGATG AGC GGGCCAAAAGCCTAATGGTGTAGTTAGAGTTTTGGTGATAATGATATGCACGGCGGACGTAAAAAACAACATAACTAACTCTTTCCACCACTAACCAAAGCCTAACACGCGTCGACATGCGAACTGCTTTACGGCTCTACCGCTACGTACACGTGCATGATAAAGAGATGCAACACAAAGCCTACCACCTCTTGGTTCGTG ACACGTCTCGCTTACGTGTT GCCAAAGAGCGTAATTAAATAATAATCACAGTTACCGACTATAGTAACACGTGGGTTTGGCATTGTCTATAT TAATGGGACATG CTCACCGAGCAAAGCATCGAACAAAAAAACACGAAGAATCATAAGCTATATATATTTTTGTAACATCTTTGAATATTACTAAGCAGGAAAAATGCAGT CGATGAAGGAAACAGCTTCA AACATCGCAGCTTCTGC CAAGTCTGGCATGGACAAG A Hap5 TTGATCAAAAGTTCAAAACTGAAACTTGGTTGCTTTTATTGGATGATGCAGGAACATGAACAAGCGCTTGTTTCTGCCATTGCAAGGCTTGCGGATGCTTCTGATTTCGAAAGCGGTAAGAAACATGAGTCTTTGTATAT GACCTG AGAATGAGTCTATTAC CTAATTTAAATCACATTGTTTGTCTGAACGACTCAATATATTTGTTTCATTCCAAGACCAGTGATGTTATGTTTTTATCTTTGGCTTTTGTGTGTTGCTGCTGAATCAGATGGAGAAGAGGCGTATATGCATGAGCTTCCAATGCATGAGGGATAGCAGTGAATAAAGAAAAGATATTCGCCCATCAAACTAAGCACACTCTTCTTATCCTTTGGACATGTAAACAAACCGGAGAAGTTTCTGCGAAGATGAAAACATTATGTATTGATTTCAAAATGTATTAAAATAATCCTTAGGAATTTTGTTTGTAAAACACATTAATTCTTTTTCAAATTTATTAATTATT GATGTGACCATCAGGTCTCT AGCCATCAAAGATTTGGCGTTATGCTTTACTGTGGTTATTGTTAAATTTGCAACATGT GTAGAATCGGTGATGATGAGC GGGCCAAAAGCCTAATGGTGTAGTTAGAGTTTTGGTGATAATGATATGCACGGCGGACGTAAAAAACAACATAACTAACTCTTTCCACCACTAACCAAAGCCTAACACGCGTCGACATGCGAACTGCTTTACGGCTCTACCGCTACGTACACGTGCATGATAAAGAGATGCAACACAAAGCCTACCACCTCTTGGTTCGTG ACACGTCTCGCTTACGTGTT GCCAAAGAGCGTAAAATAATAATCACAGTTACCGACTATAGTAACACGTGGGTTTGGCATTGTCTATAT TAATGGGACATGCTCACCG AGCAAAGCATCGAACAAAAAAACACGAAGAATCATAAGCTATATTTTTGTAACATCTTTGAATATTACTAAGCAGGAAAAATGCAGT CGATGAAGGAAACAGCTTCA AACATCGCAGCTTCTGC CAAGTCTGGCATGGACAAGA Note: The underlined primers are designed and developed molecular marker primers.

[0034] The above molecular markers were used to identify the genotype of the Brassica napus plants to be tested. The identification process was as follows: 1. Extraction of DNA from rapeseed leaves using the CTAB method (1) Take 1 cm thick young leaves from each plant. 2 Place in a 2 mL centrifuge tube, add steel beads, add 250 μL of 2% CTAB, grind on a grinder for 5 min, and then add 500 μL of CTAB to the centrifuge tube; (2) Place the plant tissue homogenate in the centrifuge tube into a centrifuge tube box, and then place it in a 65°C water bath for 60 min, shaking every 15 min; (3) After cooling to room temperature, add a 24:1 volume ratio of chloroform to isoamyl alcohol mixed solution into the centrifuge tube, gently invert upside down to mix for 15 min, and then centrifuge at 12,000 rpm for 10 min. (4) Place the centrifuged tubes in order on the operating plate, and pipette the supernatant into a new 1.5 mL centrifuge tube, with a volume of 500 μL; (5) Add 50 μL of KAc solution to the supernatant, then add 500 μL of ice ethanol, cover the centrifuge tube, shake gently a few times to mix the ice ethanol and supernatant thoroughly, and then place in a -20°C refrigerator for 20-30 min to allow the genomic DNA to precipitate; (6) After standing, centrifuge the tube at 12,000 rpm for 6 min, discard the supernatant, add 500 μL 75% ethanol and let stand for another 5 min, discard the supernatant (sometimes centrifuge for 2 min and then discard the supernatant), repeat once, and the precipitate is genomic DNA; (7) Invert the centrifuge tube containing DNA and dry it in a fume hood to obtain the genomic DNA of each plant; (8) Add 200 μL ddHO 2 0 into a dried centrifuge tube containing DNA to dissolve the DNA, and store it at -20℃ after dissolution.

[0035] 2. PCR Amplification of Molecular Markers The above molecular markers were used as primers, and the genomic DNA of the Brassica napus plants to be tested extracted by the CTAB method was used as a template for PCR amplification. The PCR amplification was a 10 μL reaction system, and each reaction system specifically included: 5 μL Vazyme 2×Taq Plus Master Mix, 0.25 μL forward primer, 0.25 μL reverse primer, 2 μL DNA template, 2.5 μL ddH 2 O.

[0036] Vazyme 2×Taq Plus Master Mix5 μL DNA template 2 μL 10 μM forward primer 0.25 μL 10 μM reverse primer 0.25 μL Ultrapure water 2.5 μL After mixing all the substances, they were covered with mineral oil. The PCR reaction program was as follows: pre-denaturation at 94°C for 5 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, a total of 35 cycles; extension at 72°C for 5 min, 1 cycle; and finally storage at 4°C.

[0037] 3. Amplification products and electrophoresis analysis The amplified products of all the Brassica napus plants to be tested were electrophoresed on a 1.5% agarose gel, stained with the nucleic acid dye ethidium bromide, and imaged under ultraviolet light to obtain the genotype information of the samples to be tested. Figure 4 , five haplotypes can be distinguished using YX1 forward and reverse primers and one Sanger sequencing. Next, the YX2-YX4 primers shown in Table 2 can be used to achieve genetic improvement of non-drought-resistant haplotype background materials. The specific operation is to determine the parent combination and then perform hybridization, and use the YX2-YX4 primers shown in Table 2 to perform molecular marker detection on the hybrid offspring. The results are shown in Figure 5As shown, the band patterns of hap1 and hap3 amplified by the forward and reverse primers YX2 were consistent, the band patterns of hap2 and hap5 were consistent, and hap4 had a single band pattern, which was consistent with expectations. The band patterns of hap1 and hap4 amplified by the forward and reverse primers YX3 were consistent, and the band patterns of hap2, hap3 and hap5 were consistent, which was consistent with expectations. The band patterns of hap1 amplified by the forward and reverse primers YX4 were consistent, and the band patterns of hap2, hap3 and hap5 were consistent, and hap4 had a single band pattern, which was consistent with expectations. In the haplotype improvement of breeding materials, the haplotypes of donor materials and recipient materials were determined by combining YX1 with Sanger sequencing; materials with non-drought-resistant haplotypes were used as recurrent parents and hybridized with materials with drought-resistant haplotypes; according to the haplotype identification results of the materials, plants with drought-resistant haplotypes in the offspring of the parental hybrids were identified using the YX2-YX4 primers shown in Table 2 and continuously backcrossed with the non-drought-resistant parents, thereby introducing drought-resistant haplotypes into the haplotype materials to be improved while keeping the genetic background basically consistent with that of the original parents; finally, through one self-pollination, homozygous drought-resistant haplotype materials were screened out in the self-pollinated offspring, thereby achieving genetic improvement of drought resistance in the haplotype materials to be improved.

[0038] Table 2. Improvement scheme for non-drought resistant haplotypes using YX2, YX3 and YX4 primers

[0039] Therefore, this molecular marker can be used to quickly and accurately detect the drought resistance of Brassica napus materials with good repeatability. Applying it to molecular assisted selection breeding of drought resistance in Brassica napus or genetic improvement of drought-sensitive materials can greatly improve the efficiency of drought-resistant variety selection and promote the breeding process.

[0040] The above embodiments are preferred implementation schemes of the present invention, and the present invention is not limited to the specific details in the above embodiments. Any modification, equivalent replacement, improvement, etc. made under the functional and structural principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A molecular marker for identification of drought resistance and genetic improvement of Brassica napus, wherein the primer nucleotide sequence of the molecular marker is: YX1 forward primer: GACCTGAGAATGAGTCTATTAC YX1 reverse primer: TCTTGTCCATGCCAGACTTG YX2 forward primer: ACACGTCTCGCTTACGTGTT YX2 reverse primer: TCGGTGAGCATGTCCCATTA YX3 forward primer: GATGTGACCATCAGGTCTCT YX3 reverse primer: GCTCATCATCACCGATTCTAC YX4 forward primer: TCACCGAGCAAAGCATCGAA YX4 reverse primer: TGAAGCTGTTTCCTTCATCG.

2. Use of the molecular marker described in claim 1 in the identification of drought resistance and genetic improvement of Brassica napus.

3. A method for identifying drought resistance and genetic improvement of Brassica napus, characterized in that The following steps are involved: 1) Extracting genomic DNA from Brassica napus; 2) using the genomic DNA extracted in step 1) as a template and performing PCR amplification using the molecular marker primers described in claim 1; 3) Detect the PCR amplification product of step 2).

4. The method for identifying drought resistance and genetic improvement of Brassica napus according to claim 3, characterized in that: The PCR amplification reaction system was 5 μL Vazyme 2×Taq Plus Master Mix, 0.25 μL forward primer, 0.25 μL reverse primer, 2 μL DNA template, and 2.5 μL ddH2O.

5. The method for identifying drought resistance and genetic improvement of Brassica napus according to claim 3, characterized in that: The reaction procedure of the PCR amplification was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 15 s, extension at 72°C for 30 s, 35 cycles; and finally extension at 72°C for 10 min.

Images