Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Wintersweet cpft gene and its application

A kind of wax plum and gene technology, applied in the field of genetic engineering, can solve the problem that the wax plum has no relevant reports, etc.

Active Publication Date: 2021-02-19
SOUTHWEST UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, multiple homologous genes of FT have been cloned, but there is no related report in Wintersweet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wintersweet cpft gene and its application
  • Wintersweet cpft gene and its application
  • Wintersweet cpft gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Cloning of embodiment 1 Wintersweet CpFT gene

[0030] 1 Primer design

[0031] According to the annotation information of the cDNA library of Wintersweet flower constructed in our laboratory, the cDNA sequence of the FT gene containing the complete ORF frame was detected. The experimental material of the cDNA library was Chimekou wintersweet planted in the school, and its flowers of different periods were used as materials to construct. Design specific primers according to the obtained cDNA sequence. The upstream and downstream primers contain the complete ORF sequence. The primer sequences are as follows:

[0032] CpFT-F CGTAGTCATCCAAGTATCTCAATC

[0033] CpFT-R TGGAACTGCTGTTGGACCTAT

[0034] The wax plum cDNA was used as a template, and the above-mentioned primers were used for PCR amplification, and a fragment of about 580 bp was amplified.

[0035]Recover the target fragment, connect it to T vector, construct the cloning vector, transform Escherichia coli compet...

Embodiment 2

[0036] Example 2 Analysis of Wintersweet CpFT Gene Expression

[0037] The roots, stems, cotyledons, young leaves, and mature leaves of Chimonanthus praecox (all collected from biennial Chimonanthus praecox seedlings, planted in the tissue culture room of the Flower Research Institute of Southwest University, under routine maintenance and management) and various flower organs Materials (all collected from adult wintersweet plants, planted on the campus of Southwest University, routine maintenance and management).

[0038] 1 Design and synthesis of real-time fluorescent quantitative PCR primers

[0039] The Actin and Tublin genes of Wintersweet were selected as the dual internal reference genes for real-time fluorescence quantification of the CpFT gene of Wintersweet. Primer Premier 5.0 software was used to design specific primers for the internal reference gene and the target gene CpFT, and then sent to Beijing Liuhe Huada Gene Technology Co., Ltd. Ltd Synthetics. All primer...

Embodiment 3

[0053] Example 3 Genetic Transformation and Functional Analysis of Wintersweet CpFT Gene in Arabidopsis

[0054] 1 Construction of CpFT gene plant overexpression vector

[0055] The CpFT gene was excised from the cloning vector, and then connected to the plant expression vector pCAMBIA2301G, and the plant overexpression vector pCAMBIA2301g-CpFT (or 35S::CpFT) of the Wintersweet CpFT gene was constructed. The vector schematic diagram is as follows Figure 4 shown.

[0056] 2 Transformation of Arabidopsis thaliana by flower bud infection

[0057] The transgenic recipient Arabidopsis thaliana (L.) Heynh was a wild Columbia type WT (Col-0), and its seeds were preserved by the Flower Research Institute of Southwest University.

[0058] 2.1 Culture of Arabidopsis

[0059] Take an appropriate amount of wild-type Arabidopsis WT seeds in a 1.5mL centrifuge tube, add a 17% sodium hypochlorite (NaClO) solution, fully oscillate and sterilize for 7 minutes, and then wash 5-6 times with ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides CpFT gene of wintersweet and its application in flowering regulation. The gene sequence of Wintersweet CpFT provided by the present invention is shown in SEQ ID No.1. The invention firstly clones and obtains the CpFT gene of Wintersweet, and verifies the function of the gene in plant Arabidopsis through transgenic technology. The results showed that the higher the expression level of CpFT gene in Wintersweet, the fewer rosette leaves of transgenic Arabidopsis thaliana, and the shorter the scape time, the first flower opening time, and the first fruit pod formation time. As the time of plant transformation from vegetative growth to reproductive growth is advanced, the vegetative growth time is shortened, the number of rosette leaves is reduced, and the flowering time is advanced. It indicated that the CpFT gene of Wintersweet can promote flowering and inhibit the vegetative growth of the plant, and this gene plays an important role in the process of breaking the dormancy of wintersweet flower buds at low temperature and leading to flower expansion and opening.

Description

technical field [0001] The present invention relates to the field of genetic engineering, in particular to the cloning of CpFT gene of Wintersweet and its application. Background technique [0002] Wintersweet (Chimonanthus praecox (L.) Link), belongs to Chimonanthus Lindl. of Calycanthaceae (Calycanthaceae), also known as golden plum, wintersweet, yellow plum, etc., is a unique precious ornamental flower and tree in my country. Wintersweet is a bushy shrub that can reach a height of 3 to 4 meters. Deciduous, opposite leaves, semi-leathery; flowers are born in leaf axils; the outermost perianth is brown scale-shaped, and turns yellow inward; the flowering period is from December to March of the next year; the fruiting period is from August to September, belonging to aggregated achenes. Wintersweet is a rare winter flowering plant. It flowers first and then leaves. It has sweet flowers, golden color, waxy petals and strong fragrance. It has high economic and ornamental valu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N1/21A01H5/00A01H6/20
CPCC07K14/415C12N15/827
Inventor 李志能刘宁江英杰眭顺照李名扬李先源
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com