Application of tomato gene slsaur58 in regulating tomato growth and drought resistance

A drought resistance and tomato technology, applied in the application field of tomato gene SlSAUR58 in regulating tomato growth and drought resistance, can solve the problems that functional research has not been involved, and the effect is unclear, so as to increase the biological yield of plants, improve drought resistance, The effect of promoting the vegetative growth process

Active Publication Date: 2019-06-25
ZHEJIANG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the role of small auxin-up RNAs (SAURs), the largest gene family among auxin primary response genes, in the auxin signaling pathway is still unclear
The functional research of SAURs in the process of plant stress resistance has not been involved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of tomato gene slsaur58 in regulating tomato growth and drought resistance
  • Application of tomato gene slsaur58 in regulating tomato growth and drought resistance
  • Application of tomato gene slsaur58 in regulating tomato growth and drought resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 Spatiotemporal expression of SlSAUR58 gene in different tissues and organs of tomato

[0022] Using the cDNA of roots, stems, leaves, flowers and fruits of the tomato variety "Micro-Tom" as a template, the spatiotemporal expression of SlSAUR58 in different parts of tomato was detected, SlSAUR58-S:

[0023] CCAATACTGGAAGACACCC (SEQ ID NO:4); SlSAUR58-A:

[0024] CACAAAACACCACCATCACC (SEQ ID NO:5). Such as figure 1 The expression of SlSAUR58 shown is the lowest in tomato roots; the expression in leaves is the highest, which can reach more than 30 times the expression in roots. Further detection of the expression of SlSAUR58 in tomato flowers at six stages revealed that the expression of SlSAUR58 was gradually increasing with the development of flowers.

Embodiment 2

[0025] Example 2 Response pattern of SlSAUR58 to drought stress

[0026] The tomato "Micro-Tom" plants that have grown to about 4 weeks are placed in an incubator with a humidity of 40%, and are subjected to water-deficient treatment. On the 0d, 3d, 6d and 9d after the water-deficient treatment, the same leaf position Leaves were collected for quantitative analysis. QRT-PCR analysis found that in the leaves of drought-treated tomato plants ( Figure 7 ), the expression level of SlSAUR58 increased significantly, and the expression level of SlSAUR58 reached the highest value 6 days after the drought treatment, which was about 6 times that of the control. Drought stress can obviously induce the expression of SlSAUR58.

Embodiment 3

[0027] The promoter analysis of embodiment 3 SlSAUR58 gene

[0028]In this study, the promoter sequence 2000bp upstream of SlSAUR58 was isolated from the tomato SGN database, and the cis-acting elements of this promoter were predicted on the PlantCare website. element), ABA (ABRE) and GA (GARE-motif) response elements.

[0029] In this study, specific primers were further designed: P58-S (SEQ ID NO: 6) and (P58-A SEQ ID NO: 7), amplified and isolated the promoter sequence of 1302 bp upstream of the SlSAUR58 gene (including the above hormone-related elements) ( figure 2 A), constructed the promoter vector of SlSAUR58, namely pSlSAUR58::GUS-GFP-PBGWFS7.0, and found that the 1300bp promoter sequence upstream of the gene of SlSAUR58 can activate the expression of green fluorescent protein, indicating that the isolated promoter sequence of SlSAUR58 with activation activity such as figure 2 B and C. The constructed vector was transformed into Arabidopsis thaliana by flower dip...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of tomato gene SISAUR58 in controlling tomato growth and drought resistance. It is discovered through series of experiments discover that by overexpression of SISAUR58 gene in two different tomato genes Micro-Tom and Ailsa Crag, all plants are dwarfed with the quantity and area of leaves significantly reduced and drought resistance improved, while by inhibitingSAUR58, nutrient growth of plants can be accelerated. A method established herein is applicable to tomato, not limited to its growth and resistance control, and is applicable to the increase of plantbiological yield and creation of novel drought-resistant varieties.

Description

technical field [0001] The present invention relates to the field of plant genetic engineering and molecular breeding, in particular to the application of tomato gene S1SAUR58 in regulating tomato growth and drought resistance. Background technique [0002] Tomato is one of the most commonly cultivated vegetables in the world, and occupies an important position in the production and consumption of vegetables in my country. Therefore, the yield, quality, stress resistance and other traits of tomato have attracted many people from all over the world to study. Excessive vegetative growth of tomato will waste too much land and fertilizer, while excessive vegetative growth will inhibit reproductive growth; and with the increasing scarcity of global water resources, drought adversity has become an important adversity that limits tomato yield and quality. At present, there are few key genes that regulate tomato vegetative growth and drought stress, and genes that simultaneously re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/82A01H5/00A01H6/82C12N15/29
CPCC07K14/415C12N15/8261
Inventor卢钢何艳军闫艳秋潘长田
OwnerZHEJIANG UNIV