Modified t cells and methods of their use

A technology of lymphocytes and cell receptors, applied in the field of modified T cells and their use, can solve the problem of low cell persistence

Pending Publication Date: 2019-09-20
THE GENERAL HOSPITAL CORP
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this approach presents its own challenges due to the recipient's immune response against the donated cells, which can result including low cell persistence, host-versus-graft effect in immunocompetent subjects, and immunocompromised Issues including graft-versus-host effect in subjects of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modified t cells and methods of their use
  • Modified t cells and methods of their use
  • Modified t cells and methods of their use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0239] Example 1: Knockout of CD3ζ in Jurkat T cells and primary T cells, and transduction of CD3ζ knockout cells with CAR

[0240] To achieve gene knockout using CRISPR, guidelines were developed targeting various coding sequences of CD3ζ, targeting CRISPR-mediated gene disruption by generating insertions and / or deletions in the targeted genomic sequence, causing loss of expression. frameshift mutation.

[0241] Knockdown of CD3ζ or T cell receptor alpha chain (TRAC) in Jurkat cells using CRISPR ( figure 1 ). The two specific guide sequences used for CD3z KO were (i) CAGTTGCCGATTACAGGTA and (ii) GTGGAAGGCGCTTTTCACCG. The resulting cells were analyzed by flow cytometry to show the effect of knockdown on the expression of the CD3 / T cell receptor complex. Both knockouts abolished the expression of the CD3 / T cell receptor in these cells compared to mock electroporated (EP) cells, and as determined by using anti-CD3e antibody at day 7 post EP. CD3ζ or TRAC ( figure 2 ). U...

Embodiment 2

[0248] Example 2: Modification of CD3ζ knockout T cells to reduce rejection

[0249] Construction of lentiviral vectors for use in transduction of T cells ( Figure 9 ). Nunchucks (pMGH81) is a gene expressing three full-length CMV proteins (UL40, US6, and UL18), click beetle green luciferase (CBG; to be used in cell killing assays and in vivo imaging), enhanced green fluorescent protein (EGFP; for downstream flow sorting), and viral 2A proteins (T2a, P2A, E2A, and F2A; for directing cleavage of the encoded polyprotein). As explained above, CMV proteins function to facilitate evasion of the immune attack of the recipient to whom T cells are administered.

[0250] Ninja (pMGH82) is a construct expressing a modified anti-human CD19_BBz chimeric antigen receptor, as well as CMV UL40CMV viral protein and signal peptide. A signal peptide is loaded onto non-classical HLA-E which, when expressed, helps inhibit NK cell killing. Also included are CMV US6 and UL18, and mCherry as ...

Embodiment 3

[0253] Embodiment 3: Knockout T cell receptor alpha chain (TRAC)

[0254] TRAC was targeted using an approach similar to that described above for CD3ζ. The specific gRNA used for TRAC is AGAGTCTCTCAGCTGGTACA. Such as Figure 14 As shown in , knockdown of TRAC (AGAGTCTCTCAGCTGGTACA) or CD3ζ (GTGGAAGGCGCTTTTCACCG) in primary T cells caused knockdown of cell surface expression of TCR at day 8 after electroporation / day 12 after stimulation.

[0255] Various aspects of the invention are described in the following numbered paragraphs.

[0256] 1. An isolated T lymphocyte modified to have reduced expression of CD3ζ, T cell receptor alpha chain (TRAC), and / or T cell receptor beta chain (TRBC) genes due to reduced or eliminated CD3ζ Depleted or abolished T cell receptor (TCR) expression.

[0257] 2. The isolated T lymphocyte of paragraph 1, which comprises a CD3ζ, TRAC, and / or TRBC gene, regulatory sequence, coding sequence, exon, or portion thereof mutated, resulting in reduced,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The technology described herein relates to modified T cells and their use in immunotherapeutic methods. In various examples, the T cells are modified so as to decrease or eliminate OD3zeta, TRAC, and / or TRBC expression.

Description

technical field [0001] The technology described herein relates to modified T cells and their use in immunotherapeutic methods. [0002] Background of the invention [0003] Adoptive T cell therapy involves the administration of antigen-specific T cells to treat diseases, including cancer, infectious diseases, and autoimmune diseases. T cells used in such therapy can be isolated from a subject and selected for a desired, pre-existing specificity. As an example, tumor infiltrating T lymphocytes can be isolated from a subject, expanded ex vivo, and then administered to treat cancer in the subject. In other approaches, T cells can be modified ex vivo to acquire new specificities. In one example of such an approach, T cells are genetically modified ex vivo to express a chimeric antigen receptor (CAR). CARs provide a means of directing cytotoxic T-cell responses to target cells expressing a selected target antigen, most commonly a tumor antigen or tumor-associated antigen. A CA...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/0783A61K35/17
CPCC12N5/0636C12N2501/515C12N2510/00C07K2319/03C07K14/7051A61K39/4611A61K39/464412A61K2239/26A61K39/4631A61K39/464838A61K35/17C07K14/005C12N2710/16122
InventorM·V·莫斯M·弗里高特M·科波德
OwnerTHE GENERAL HOSPITAL CORP