Unlock instant, AI-driven research and patent intelligence for your innovation.

Absolute quantitation of nucleic acids by RT-PCR

A RT-PCR, absolute quantitative technology, applied in the field of molecular biology, can solve time-consuming, laborious and infeasible problems

Inactive Publication Date: 2006-04-12
BIOGEN MA INC
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this absolute quantification method is time-consuming and laborious, making it infeasible when a large number of different targets must be quantified by real-time PCR

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Absolute quantitation of nucleic acids by RT-PCR
  • Absolute quantitation of nucleic acids by RT-PCR
  • Absolute quantitation of nucleic acids by RT-PCR

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0037] Primers, probe design and oligonucleotide templates

[0038] Taqman forward and reverse primers and a 5'FAM labeled MGB probe were designed from the Affymetrix consensus sequence using PrimerExpress(R) (Applied Biosystems). Oligonucleotide templates for in vitro transcription can be constructed by adding 10 base pairs of gene-specific sequence to the 5' and 3' ends of the amplicon, followed by the addition of 10 base pairs 3' to the T7 promoter region Outside of the base pair, the T7 promoter consists of 5'CCTATAGTGAGTCGTATTA 3' (SEQ ID NO: 1).

[0039] In vitro transcription using synthetic oligonucleotides

[0040] In vitro transcription reactions using partial single-stranded oligonucleotide templates were performed using a commercially available kit (T7-MEGAshortscript Kit, Ambion Inc., Austin, TX). Part of the single-stranded template was passed through the T7 primer (5'AATTTAATACGACTCACTATAGG 3'), which was only in the T7 promoter region (in 10mM Tris-HCl (pH 8....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for obtaining a cRNA for use in generating calibration data, e.g., a standard curve, for absolute quantitation of RNA by RT-PCR is disclosed. The method includes the steps of: providing a synthetic oligonucleotide comprising an amplicon, a promoter sequence located 3' relative to the amplicon; synthesizing complementary RNA (cRNA) by in vitro transcription of the synthetic oligonucleotide; quantitatively assaying the cRNA by an independent method; and generating calibration data using a known quantity of the cRNA.

Description

technical field [0001] The present invention relates to molecular biology. More specifically, the present invention relates to real-time PCR methods and absolute quantification of gene expression. Background technique [0002] Basic PCR techniques are suitable for amplifying a DNA sequence of interest. In reverse transcriptase PCR (RT-PCR), a reverse transcription step is added to the PCR protocol. This employs a basic PCR method for detecting and quantifying specific mRNA transcripts. Therefore, RT-PCR is suitable for determining and comparing gene expression levels. Examples of useful comparisons include expression in different tissue types of a single organism, expression in the same tissue type in different organisms, and expression in the same tissue type in response to an experimental treatment. Quantification can be relative (ie, expressed as a fold difference between samples) or absolute (ie, expressed as the actual amount of RNA). [0003] Historically, followi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12P19/34A61K
CPCC12Q1/6851C12Q2525/173C12Q2545/113C12Q2525/143C12Q2521/107
Inventor 诺曼德·E·阿莱尔
Owner BIOGEN MA INC