Unlock instant, AI-driven research and patent intelligence for your innovation.

Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof

A rapid diagnosis technology for Staphylococcus aureus, which is applied in the direction of microorganism-based methods, microbial measurement/inspection, biochemical equipment and methods, etc., can solve the problems of the genetic rapid diagnostic kit for detecting Staphylococcus aureus, etc., and achieve Significant color difference, high specificity, rapid amplification effect

Active Publication Date: 2009-10-28
GUANGZHOU HUAFENG BIOTECH
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, isothermal amplification (Isothermal Amplification) nucleic acid rapid detection technology is a great progress in pathogenic nucleic acid detection technology. The established loop-mediated isothermal amplification technology (loop-mediated isothermal amplification of DNA, LAMP) has many advantages. and there is currently no gene rapid diagnostic kit for the detection of Staphylococcus aureus using loop-mediated isothermal amplification technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof
  • Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof
  • Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] The preparation of embodiment 1 kit

[0042] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0043] Outer primer F3: TTTTCATAATCRATCACTGGAC, as shown in SEQ ID NO: 1;

[0044] Outer primer B3: TTTAACAGCTAAAGAGTTTGGT, as shown in SEQ ID NO: 2;

[0045] Internal primer FIP: ACAATAATAACGAGGTYATTGCAGCTTTTCTTGAACACTTTCATAACAGGTAC, as shown in SEQ ID NO: 3;

[0046] Internal primer BIP: CCTTCAGCAAGCTTTAACTCATAGTTTTTCAGATAGCATGCCATACAGTC, as shown in SEQ ID NO: 4;

[0047] (2) Purchase DNA polymerase: Bst DNA polymerase (Large Fragment). Put in container.

[0048] (3) Preparation of reaction solution: the reaction solution contains 2mmol / LdNTP, 25mmol / L Tris-Cl, 12.5mmol / L potassium chloride, 12.5mmol / L ammonium sulfate, 10mmol / L magnesium sulfate, 0.125% TritonX-100, 1mol / L L betaine, 2 mol / L each of the inner primers FIP / BIP and 0.25 mol / L each of the outer primers F3 / B3 were placed in the container.

[0049] (4) ...

Embodiment 2

[0060] The preparation of embodiment 2 kit

[0061] The formula of the reaction solution is: the reaction solution contains 1.8mmol / L dNTP, 20mmol / L Tris-HCl, 10mmol / L potassium chloride, 10mmol / L ammonium sulfate, 8mmol / L magnesium sulfate, 0.1%TritonX-100, 0.8mol / L betaine, each 1.6mol / L of inner primer FIP / BIP and each 0.2mol / L of outer primer F3 / B3;

[0062] The formula of the sample pretreatment solution is as follows: the sample pretreatment solution contains 10 mmol / L Tris-HCl with pH 8.0, 1 mmol / L EDTA and 1% Triton X-100.

[0063] Others are the same as embodiment 1.

Embodiment 3

[0064] Application of embodiment 3 Staphylococcus aureus gene rapid diagnosis kit

[0065] 1 Materials and methods

[0066] 1.1 Materials

[0067] 1.1.1 Strains

[0068] There are 22 strains used in our company, mainly from the American Standard Biological Collection Center,

[0069] China Institute for the Control of Pharmaceutical and Biological Products and clinical separation. See Table 1 for details.

[0070] Table 1 strain name and source

[0071] strain source

Strain and serial number

American Standard Biological Collection

Center (ATCC)

Staphylococcus aureus (6538), Salmonella (14028, 13076,

13311), Listeria (7466, 25401);

Preservation of Medical Microorganisms

Management Center (CMCC)

Salmonella (50115);

Clinical isolates

Staphylococcus aureus, Vibrio parahaemolyticus, Shigella, enterocolitis

Yersinia, Salmonella choleraesuis, Salmonella enteritidis, Salmonella typhimurium

Bacteri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and a detecting method thereof. The diagnostic kit is composed of two pairs of primers, DNA polyase, a reaction solution, a sample pretreating solution, a developing solution and a masculine contrast solution which are respectively installed in a container. The rapid diagnostic kit for gene according to the invention can determine the existence of target substance according to whether amplification exists through applying six sections and four primers, and therefore has high specificity. The rapid diagnostic kit for gene according to the invention has the advantages of high speed, high activity, high sensitiveness, capacity for executing the amplification reaction with only one constant temperature, no requirement of specific agent or device, and low detecting cost. The determination of the rapid diagnostic kit for gene according to the invention is convenient. The pyrophosphoric acid group ions precipitated from the dNTP are combined with the Mg in the reaction solution. The subsidiary product of magnesium pyrophosphate precipitate is generated and can be observed and determined visually. Furthermore after the developing solution is added, the difference of developing color between the negative result and the positive result is remarkable, and is more evident and reliable.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a rapid diagnosis kit for Staphylococcus aureus gene and a detection method thereof. Background technique [0002] At present, there are a variety of detection methods for Staphylococcus aureus, ranging from national standards (GB / T4789. Nucleic acid probes, polymerase chain reaction (PCR) technology and other molecular biological detection methods [Food Safety Testing and Modern Biotechnology, Chemical Industry Press, 2004]. Among them, the detection of pathogenic nucleic acids has greatly improved in terms of rapidity, safety, accuracy and sensitivity. These new technologies try to break through the traditional microbiological detection modes such as morphology and biochemical reactions, and do not need to separate microorganisms. Purification, and directly use the sample or sample enrichment solution to quickly detect its gene and gene product, and combine with molecular biol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12R1/445
Inventor 曹以诚陈洵李志勇杜正平谭慧媚李心晖王志强高东微邓小玲柯昌文
Owner GUANGZHOU HUAFENG BIOTECH