A differential gene between commercial Bumblebee and wild Bumblebee and its molecular markers and applications

A wild ground bear and differential gene technology, applied in the field of mutation or genetic engineering, can solve the problems of inability to provide theoretical guidance for breeding by breeders, the number of tested individuals is small, and the actual effect is not large, so as to facilitate indoor breeding and improve detection. Efficiency, strong pollination effect

Active Publication Date: 2020-12-25
BEE RES INST CHINESE ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The applicant’s application number on April 25, 2019 is 201910338173.7, and the name is a patent application that can identify the molecular markers of commercial Bumblebee and its application. However, the number of tested individuals is small and the accuracy is not high. The difference site of the present invention is Detected from 54 wild bumblebees and 24 commercial bumblebees worldwide, the accuracy is higher than before; and the molecular marker of the patent application 201910338173.7 is located in the intergenic region, although it can effectively distinguish commercial bumblebees from wild bumblebees Bumblebee, but its practical effect is not great, and it cannot provide theoretical guidance for breeders to carry out molecular assisted marker breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A differential gene between commercial Bumblebee and wild Bumblebee and its molecular markers and applications
  • A differential gene between commercial Bumblebee and wild Bumblebee and its molecular markers and applications
  • A differential gene between commercial Bumblebee and wild Bumblebee and its molecular markers and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Perform resequencing analysis on 24 imported commercial Bumblebee (purchased from the Netherlands Cobert Company) and 54 wild-type Bumblebee to find the differential genes between commercial Bumblebee and wild-type Bumblebee. The specific steps are as follows:

[0032] 1. There are three main sources for the collection of Bumblebee samples worldwide, namely: Bumblebee from Xinjiang, China, a commercial Bumblebee from Europe, and Bumblebee specimens from the British Museum of History and Nature. The samples cover 10 countries and regions around the world, including 7 European countries—UK, France, Germany, Switzerland, Sweden, Turkey, and Russia, and 3 Asian countries—China, Tajikistan, and Kyrgyzstan;

[0033] 2. DNA extraction, quality control and genome repair, a total of 78 ground bumblebee genomes were extracted;

[0034] 3. Preparation of sequencing library and genome resequencing, add 5 × TAB, 2ul PPM, 2ulN5, 2ul N7, 1ul TAE, ddH to the DNA in proportion 2 O was ...

Embodiment 2

[0041] 1. Discovery of specific molecular marker sites

[0042] By resequencing the genomes of 54 wild Bumblebees (samples were collected in Xinjiang, my country and 9 countries in Europe and Asia) and 24 commercial Bumblebees (purchased from the Netherlands Cobert Company), using bioinformatics methods , a specific SNP site was identified in the bumblebee genome, and the site was named NC015772.1_15245950. At the NC015772.1_15245950 locus, all commercial Bumblebees have the same genotype (both CC), all wild Bumblebees have the same genotype (all are TT), and the commercial and wild Bumblebee Genotypes are not the same (instructions attached figure 1 ). figure 1 The SNP site is shown, and only the sequence alignment results of some bumblebee individuals are shown here.

[0043] On the Bumblebee reference genome, the SNP site and the flanking sequence are 5'-CGCTTCGCTCGAGATCGATTCCGTAATTGG(T / C)TCTTGGCTAGTGGATGCCACTTGCGTAACA-3'; wherein the 31st nucleotide of the sequence is th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a differential gene of commercial bumblebees and wild bumblebees as well as a molecular marker and an application of the differential gene. The differential gene is a specificSNP site NC015772.1_15245950; the SNP site is located in a bumblebee gene LOC100649549, and the SNP site and the flanking sequence of the SNP site are 5'- CGCTTCGCTCGAGATCGATTCCGTAATTGG (T / C) TCTTGGCTAGTGGATGCCACTTGCGTAACA -3', wherein the 31st nucleotide (T / C) of the sequence is the specific SNP site. The method provided by the invention is rapid and accurate in detection, is not affected by theenvironment, is clear in selection target, and greatly improves the detection efficiency of imported commercial bumblebees.

Description

technical field [0001] The invention belongs to the technical field of variation or genetic engineering, and relates to a differential gene between commercial Bumblebee and wild Bumblebee and its molecular marker and application. Background technique [0002] At present, the identification of bee species mainly relies on morphological identification, and the error is relatively large. Especially the identification of the same bee species such as Bumblebee is more difficult to quickly identify from the shape, even using the barcoding technology based on the mitochondrial COI gene. [0003] The quick distinction between commercial Bumblebee and wild Bumblebee introduced from abroad is very important for evaluating the biological invasion status of imported commercial Bumblebee and protecting ecological security. [0004] Therefore, it is necessary to develop a biological method to quickly and easily distinguish wild and imported commercial Bumblebee, and at the same time, acco...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6888C12Q2600/13C12Q2600/156C12Q2600/172C12Q2531/113
Inventor 苏龙孙成
Owner BEE RES INST CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap