Streptomycete recombinant bacterium for enhancing synthesis capability of ectoine and hydroxyectoine and application of streptomycete recombinant bacterium

Abstract

The invention discloses a streptomycete recombinant bacterium for enhancing the synthesis capability of ectoine and hydroxyectoine and application of the streptomycete recombinant bacterium. According to the invention, streptomyces SCUT-1 is taken as a starting strain, and an efficient promoter scutP1 is utilized to carry out overexpression on a coding gene for synthesizing ectoine and a coding gene for synthesizing hydroxyl ectoine. Compared with the original strain streptomyces SCUT-1, the tetrahydropyrimidine and hydroxyl tetrahydropyrimidine synthesis capability and hyperosmosis resistance of the recombinant strain are obviously improved, the degradation efficiency of the recombinant strain is obviously enhanced, and waste feathers, cottonseed meal and shrimp shells can be directly used as the unique carbon and nitrogen source for fermentation; and the yields of the recovered highest soluble amino acid and polypeptide are respectively 2.15, 1.18 and 1.15 times of those of the original strain. The method has great significance in high-value conversion of agricultural wastes, does not need to additionally add a reducing agent, has mild reaction conditions, and has important values for reducing the production cost and improving the yield.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a Streptomyces recombinant bacterium with enhanced synthesis ability of ectoine and hydroxyectoine and application thereof. Background Art

[0002] Every year, a large amount of waste is generated in the global agricultural production process, including poultry feathers, shrimp shells, soybean meal, rice husks, corn stalks, etc. According to statistics, about 12 million tons of feathers, 8 million tons of shrimp shells, and more than 300 million tons of soybean meal and straw are produced each year in the world. These wastes are rich in protein, cellulose, chitin and other components, and have potential economic value. However, due to the difficulty of processing and the immaturity of recycling technology, most agricultural waste is discarded, incinerated or landfilled, resulting in resource waste and environmental pollution.

[0003] In recent years, as people pay more and more attention to environmental issues, many researchers have begun to work on the development and application of agricultural waste, such as using it as animal feed or organic fertilizer, etc. At present, the traditional treatment methods for agricultural waste mainly use physical and chemical methods.

[0004] Physical treatment requires high energy consumption and has limited treatment effect. It can only obtain a single product, making it difficult to achieve efficient utilization of waste. Chemical treatment has problems of environmental pollution and high cost. The chemical reagents used are prone to produce harmful byproducts, increasing the risk of secondary pollution. At the same time, the treatment process is complicated and has certain safety hazards. These factors limit the effectiveness of traditional treatment methods in large-scale applications of agricultural waste and promote the exploration of more environmentally friendly and efficient treatment technologies. The biological method has mild reaction conditions and less secondary pollution, and is an environmentally friendly recycling method. The biological method includes enzymatic hydrolysis and microbial degradation, which refers to the use of enzymes produced by microorganisms or direct use of microorganisms to treat agricultural waste, and degrade materials rich in protein, cellulose, chitin, etc. into soluble polypeptides, amino acids, reducing sugars, chitosan oligosaccharides, etc. Although the enzymatic method has the advantages of being green and sustainable, the production and purification costs of enzymes are high, especially when the cost increases significantly when applied on a large scale. In addition, enzymatic treatment usually requires a long reaction time and is less efficient when treating a large amount of waste. These factors limit the widespread application of enzymatic methods in agricultural waste treatment. Microbial fermentation is currently the fastest-growing and most promising method. This method mainly uses microorganisms such as bacteria and fungi to degrade agricultural waste. Compared with traditional treatment methods, microbial fermentation can efficiently degrade complex organic matter. The fermentation process is usually carried out under mild conditions, without high temperature and high pressure or strong acid and alkali, with low energy consumption and environmental friendliness. In addition, valuable by-products such as biofertilizers, enzymes, antibiotics, etc. can be produced during the fermentation process, further improving the resource utilization rate of waste. Finally, the microbial fermentation method has strong adaptability and can treat various types of agricultural waste. It has flexible processes and is easy to apply on a large scale. However, the microorganisms currently screened have a low efficiency in degrading agricultural waste and are difficult to meet the needs of industrial production. Therefore, genetic engineering of microorganisms to further enhance the degradation ability of microorganisms is the key to achieving efficient and green recycling of agricultural waste in the future. Therefore, it is necessary to obtain new microbial strains that can efficiently degrade and recycle agricultural waste. Summary of the invention

[0005] The primary purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide an application of overexpression of coding genes for synthesizing ectoine and hydroxyectoine.

[0006] Another object of the present invention is to provide a recombinant bacterium overexpressing the coding genes for synthesizing ectoine and hydroxyectoine and its application.

[0007] The purpose of the present invention is achieved through the following technical solutions: Application of overexpression of coding genes for synthesizing ectoine and / or overexpression of coding genes for synthesizing hydroxyectoine in promoting the synthesis of ectoine and hydroxyectoine by Streptomyces.

[0008] Furthermore, the coding gene for synthesizing ectoine includes ectA, ectB and ectC At least one of the following; the coding gene for the synthesis of hydroxytetrahydropyrimidine is ectD .

[0009] Furthermore, the gene encoding the synthesis of ectoine ectA The sequence is (also shown in SEQ ID No.1): .

[0010] Furthermore, the gene encoding the synthesis of ectoine ectB The sequence is (also shown in SEQ ID No.2):

[0011] Furthermore, the gene encoding the synthesis of ectoine ectC The sequence is (also shown in SEQ ID No.3): GTGATCGTTCGTTCCTTCAAGGACATCGAGGGCACCGACCGCGACGTGACCGCCGAGACCGGCACCTGGCGCAGCAAGCGCATCGTCCTGGCAAAGGAGGGCGTGGGCTTCTCCCTGCACGAGACGGTGATGTACGCGGGCACCGAGACCTCCATGTGGTACGCCAACCACTACGAGGCGGTGCTGTGCGTCGAGGGCGAGGGGGAGCTGACCAACGACGAGACC GGCGAGAAGCACTGGATCTCCCCCGGCACCATGTACCTGCTCGACGGCCACGAGAAGCACGATGCGGCCCAAGACGGACCTGCGCTTCGTCTGCGTGTTCAACCCCCCGGTCACCGGCCGCGAGGTCCACGACGAGAACGGCGTGTACCCCCTGCTGACCGAGCCCCTTCCCGAGCGGCCGAGGCCGCTGCGGCGCACGCCGCGGAGGCCGCCTCCGCCTGA.

[0012] Furthermore, the gene encoding the synthesis of hydroxyectoine ectD The sequence is ectD (also shown in SEQ ID No.4): ATGACCACGGCACCCGAACGCATCGCGGACCTGTATCCCACCCGTGGCACGAGCGAGGTGCTGACCGCCCGACAGGACCCGGTCGTCTGGTCCGCCCCGGGCACCCCCGGCCCCGTCTCCCCGGAGGACCTGGCCGGCTTCGAGCACGACGGCTTCCTCACCGTCGACCGGCTCCTCGCCCCCGACGAGGTCGCCCGCTACAAGGCCGAGCTCGACCGCCTGTGCGCCGACCCCGTCATGCGGGCCGACGAGCGCTCCGTCGTGGAGCCCAAGTCCGAGTCGATCCGCTCGATCTTCGAGATCCACAAGGTCAGCGAGGTCTTCGCCGAGCTGGTCAGCGACCCCCGCGTCCTCGACCGCGCCCGGCAGATCCTCGGCTCCGACGTCTACGTCCACCAGAGCCGCGTCAACGTCAAGCCCGGTTTCGGCGCCAGCGGCTTCTACTGGCACTCCGACTTCGAGACCTGGCACGCCGAGGACGGCCTGCCCCGCATGCGCACCGTCTCGATCTCCATCGCGCTGACCGAGAACCTGCCCACCAACGGCGGGCTGATGATCATGCCGGGCTCCCACAGGACCTTCGTCGGCTGCGCGGGCGAGACCCCCCGGGACAACTACAAGAAGTCCCTGCAGATGCAGGACGCCGGCACCCCCTCCGACGAGGCCCTGACGAGGATGGCCGACGCCCACGGCATCCGCCTGTTCACCGGCCCCGCCGGCTCGGCCACGATGTTCGACTGCAACGCCATGCACGGCTCCGGCGACAACATCACGCCCTACCCGCGCAGCAACGTCTTCATCGTCTTCAACAGCGTCGAGAACGCCGCGGTCGAACCCTTCGCCGCCCCTGTGCGCAGGCCCGAGTTCATCGGCGCCCGCGACTTCACCCCCGTCAGCCGCAAGGCCTGA。

[0013] Furthermore, the overexpression of the coding gene for synthesizing ectoine and / or the overexpression of the coding gene for synthesizing hydroxyectoine is: gene ectABCD is overexpressed and geneectD Overexpression ， The gene ectABCD The sequences are SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4 connected in sequence.

[0014] Furthermore, the Streptomyces includes Streptomyces SCUT-1.

[0015] Gene ectABCD Overexpression and gene ectD Application of overexpression in improving the tolerance of Streptomyces to hyperosmotic environment.

[0016] Furthermore, the gene ectABCD The sequences are SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4 connected in sequence.

[0017] Furthermore, the gene ectD The sequence is shown as SEQ ID No.4.

[0018] Furthermore, the Streptomyces includes Streptomyces SCUT-1.

[0019] Application of overexpression of coding genes for synthesizing ectoine and / or overexpression of coding genes for synthesizing hydroxyectoine in improving the ability of Streptomyces to degrade agricultural waste.

[0020] Furthermore, the coding gene for synthesizing ectoine includes ectA, ectB and ectC At least one of the following; the coding gene for the synthesis of hydroxytetrahydropyrimidine is ectD Furthermore, the ectA The sequence is shown in SEQ ID No. 1, and the ectB The sequence is shown in SEQ ID No.2, ectC The sequence is shown in SEQ ID No. 3, and the ectD The sequence is shown in SEQ ID No.4; Furthermore, the overexpression of the coding gene for synthesizing ectoine and / or the overexpression of the coding gene for synthesizing hydroxyectoine is: ectABCD Overexpression and gene ectD Overexpression ， The gene ectABCD The sequences are SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4 connected in sequence.

[0021] Furthermore, the Streptomyces includes Streptomyces SCUT-1.

[0022] Furthermore, the degradation of agricultural waste is to degrade biomass into amino acids and polypeptides; further, the biomass includes at least one of feathers, cottonseed meal and shrimp shells.

[0023] Gene ectABCD Application of overexpressed Streptomyces in degradation of agricultural waste.

[0024] Furthermore, the gene ectABCD The original strains of Streptomyces that were overexpressed include Streptomyces SCUT-1.

[0025] Furthermore, the gene ectABCD The sequences are SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4 connected in sequence.

[0026] Furthermore, the above-mentioned overexpression is performed by using an overexpression promoter scutP1, and the nucleic acid sequence of the promoter scutP1 is (also shown in SEQ ID No. 5): CGGCCCCTGAGCACGAAGTAGGCGCCGACGGCCAGCAGCAGCTGCGCCCAGGCCGCCAGGAGCACCAGTCCCCGGTCCGCCATCGTCCGCCCTCCGCCCTTGCCTCCGTGTGGGCGGCCGCCTACCCCGGCCCCCGCGTCCGGATGCGCGGCGGCCGGCAGGCACCCGTCCGGTGTGCGGCCGGGCGGGGGGCCGTCCCGCCGGGCGGGGGCCGTCCCGCCG GGCGGGGCCCGGGTCCTACCACTCCGGGGGCGTGGATTTTCGGACGTTTCCGCCGGGCGAGGGGGTACGGCGCCCGCGGGCCCGGCCCCACCCTATGCTTTCTACATGTCTGTAGAAACAAGCGAGGGCGGTGCGGGCCTCCCCTGCCGTCCTGCGGGACGCGGTCGTCCGGCCCGGCCGGGCCCCGGCCCGCACCTCTCTCTTTCGCATTCGTCCCCGGAAGGACCGTC.

[0027] Furthermore, the degradation of agricultural waste is to degrade biomass into amino acids and polypeptides; further, the biomass includes at least one of feathers, cottonseed meal and shrimp shells.

[0028] Gene ectABCD Overexpression and gene ectD Application of overexpressed Streptomyces in degradation of agricultural waste.

[0029] Furthermore, the gene ectABCD The original strains of Streptomyces that were overexpressed include Streptomyces SCUT-1.

[0030] Furthermore, the gene ectABCD The sequences are SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4 connected in sequence.

[0031] Furthermore, the gene ectD The sequence is shown as SEQ ID No.4.

[0032] Furthermore, the above-mentioned overexpression is performed by using an overexpression promoter scutP1.

[0033] Furthermore, the degradation of agricultural waste is to degrade biomass into amino acids and polypeptides; further, the biomass includes at least one of feathers, cottonseed meal and shrimp shells.

[0034] A recombinant Streptomyces bacterium, comprising a recombinant vector; the recombinant vector comprises a promoter scutP1; the recombinant vector also comprises a gene ectABCD .

[0035] Furthermore, the gene ectABCD The sequence is SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4 connected in sequence; Furthermore, the recombinant vector also contains the gene ectD , the gene ectD The sequence is shown in SEQ ID No.4; Furthermore, the nucleic acid sequence of the promoter scutP1 is shown in SEQ ID No.5.

[0036] Furthermore, in the recombinant vector, the nucleic acid sequence of the promoter scutP1 is connected to the gene ectABCD Furthermore, in the recombinant vector, the nucleic acid sequence of the promoter scutP1 is connected to the gene ectABCD The sequence of the promoter scutP1 is then connected to the nucleic acid sequence of the gene ectDsequence.

[0037] Furthermore, the original strain of the recombinant Streptomyces includes Streptomyces SCUT-1.

[0038] The application of the above-mentioned Streptomyces recombinant bacteria in degrading agricultural waste.

[0039] The above application in degrading agricultural waste comprises the following steps: inoculating the above bacteria into a fermentation medium and fermenting; The fermentation medium uses agricultural waste as the only carbon source and nitrogen source.

[0040] Furthermore, the fermentation medium includes agricultural waste; further, the agricultural waste includes at least one of feathers, cottonseed meal and shrimp shells. Further, the fermentation medium also includes water.

[0041] Furthermore, the fermentation conditions are: 30-45°C, 150-250 rpm, and a culture time of 72-120 h, preferably 40°C, 220 rpm, and a culture time of 72 h.

[0042] Furthermore, the bacteria are cultured in seed liquid, that is, inoculated in a seed culture medium to obtain a seed liquid; Furthermore, the seed culture medium includes the following components: 10.0 g / L tryptone, 10.0 g / L sodium chloride and 5.0 g / L yeast extract.

[0043] Furthermore, the inoculation amount of the seed liquid is 1% of the volume of the fermentation medium.

[0044] Compared with the prior art, the present invention has the following advantages and effects: (1) The present invention uses the endogenous high-efficiency promoter scutP1 of the starting strain Streptomyces SCUT-1 to construct two recombinant Streptomyces strains that overexpress ectoine and hydroxyectoine by genetic engineering technology. Compared with the starting strain, the ability of the recombinant strain to synthesize ectoine and hydroxyectoine has been significantly improved.

[0045] (2) The recombinant Streptomyces constructed by the present invention can ferment agricultural waste in a fermentation medium with lower moisture content, thereby reducing water usage and the time and cost of drying the fermentation product.

[0046] (3) The present invention uses agricultural waste as the sole carbon and nitrogen source to prepare the fermentation medium, degrades the agricultural waste by microbial degradation, recovers soluble amino acids and polypeptides, and can synthesize higher-value ectoine and hydroxyectoine. It has the advantages of being green and efficient, and realizes the high-value conversion of cheap waste.

[0047] (4) The present invention does not require the use of complex pretreatment processes, does not require a separate enzyme preparation process, and does not require the use of reducing agents, acids, alkalis, or other toxic chemical reagents. It has the advantages of mild reaction conditions, simple process, low cost, and green environmental protection.

[0048] (5) The fermentation product prepared by the present invention can be used as a high-quality raw material for animal feed, plant organic fertilizer and other products and can be used in agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 This is a map of the recombinant vector pSET152-scutP1-ectABCD.

[0050] Figure 2 This is a map of the recombinant vector pSET152-scutP1-ectD.

[0051] Figure 3 This is a map of the recombinant vector pSET152-scutP1-ectABCD-scutP1-ectD.

[0052] Figure 4 It is a comparison chart of the contents of ectoine and hydroxyectoine measured in LB medium of the starting strain Streptomyces SCUT-1, the recombinant bacteria SCUT-ectABCD and the recombinant bacteria SCUT-ectABCD-ectD.

[0053] Figure 5 It is the growth curve of the starting strain Streptomyces SCUT-1 and the recombinant strain SCUT-ectABCD-ectD in LB culture medium with different sodium chloride concentrations and the comparison chart of the measured ectoine and hydroxyectoine contents.

[0054] Figure 6 This is a comparison chart of the amino acid and peptide recovery in feather culture medium with different material-liquid ratios during solid-state fermentation of the starting strain Streptomyces SCUT-1 and the recombinant strain SCUT-ectABCD-ectD, as well as the content of ectoine and hydroxyectoine in the fermentation products. DETAILED DESCRIPTION

[0055] The present invention will be described in further detail below in conjunction with Examples and accompanying drawings, but embodiments of the present invention are not limited thereto. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise specified, reagents and raw materials used in the present invention can be obtained commercially.

[0056] Example 1 Overexpression of genes encoding ectoine and hydroxyectoine / construction of recombinant Streptomyces bacteria encoding genes encoding ectoine and hydroxyectoine and genes encoding hydroxyectoine 1. Cultivation of Streptomyces SCUT-1 Streptomyces sp. SCUT-1 was inoculated in an appropriate amount on a solid Gao's medium No. 1 plate (solid Gao's medium No. 1 was composed of the following components: 20 g soluble starch, 1 g potassium nitrate, 0.5 g dipotassium hydrogen phosphate, 0.5 g magnesium sulfate heptahydrate, 0.5 g sodium chloride, 0.01 g ferrous sulfate heptahydrate, 20 g agar powder and 1 L distilled water), and cultured at 37 ° C for 5 to 7 days until gray-green spores were produced. The Streptomyces sp. SCUT-1, with a deposit number of GDMCC No: 60612, was deposited in Guangdong Provincial Microbiological Culture Collection Center, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, on March 20, 2019, and has been disclosed in Chinese invention patent application CN201910491700.8.

[0057] 2. Extraction of genomic DNA from Streptomyces SCUT-1 (1) Using an inoculation loop, pick up the spores of Streptomyces SCUT-1 obtained in step 1 and inoculate them into a seed liquid culture medium (the seed culture medium consists of the following components: 10 g of tryptone, 10 g of sodium chloride, 5 g of yeast extract, and 1 L of distilled water), and culture the culture medium at 37°C and 220 rpm with shaking for 24 h to obtain a seed liquid of Streptomyces SCUT-1.

[0058] (2) Take 1 mL of Streptomyces SCUT-1 seed solution and use the soil genomic DNA rapid extraction kit (purchased from Sangon Biotechnology Co., Ltd.) to extract genomic DNA. The extraction steps were performed according to the standard procedures in the kit manual.

[0059] 3. Preparation of Streptomyces SCUT-1 spore stock solution The spores of Streptomyces SCUT-1 obtained in step 1 were picked up with an inoculation loop and inoculated into a spore preservation medium (the spore preservation medium consisted of the following components: 16 g of tryptone, 10 g of yeast extract, 5 g of sodium chloride and 1 L of distilled water), and stored at 4° C. for 5 to 7 days to obtain a SCUT-1 spore preservation solution.

[0060] 4. Construction of recombinant vectors pSET152-scutP1-ectABCD, pSET152-scutP1-ectD, and pSET152-scutP1-ectABCD-scutP1-ectD The pSET152-scutP1 plasmid (the construction of pSET152-scutP1 has been disclosed in the patent "A promoter for overexpressing protease, Streptomyces recombinant bacteria, and construction method and application thereof, Publication No.: CN 115927332A") was treated with NdeI restriction endonuclease and purified and recovered to obtain the pSET152-scutP1 linearized vector.

[0061] Using the genome of Streptomyces SCUT-1 as a template, primers ectA-Fw (5'- CGGAAGGACCGTC CAATGACCGCCGCACAAGCTGAAC-3') (the underlined part indicates the homologous fragment required for seamless cloning) and ectD-Rv (5'- TC TAGAGGATCCCCAACA TCAGGCCTTGCGGCTGAC-3') (the underlined part indicates the homologous fragment required for seamless cloning and connection), and the ectABCD fragment was recovered by PCR amplification and purification.

[0062] Using the genome of Streptomyces SCUT-1 as a template, primers ectD-Fw (5'- CGGAAGGACCGTC CAATGACCACGGCACCCGAA') (the underlined part indicates the homologous fragment required for seamless cloning) and ectD-Rv (5'- TCTAGAG GATCCCCAACA TCAGGCCTTGCGGCTGAC-3') (the underlined part indicates the homologous fragment required for seamless cloning and connection), and the ectD fragment was recovered by PCR amplification and purification.

[0063] The pSET152-scutP1 linearized vector was seamlessly cloned and connected with the ectABCD fragment and the ectD fragment, respectively. The connection reagent used was TSINGKE TSV-S1 TreliefSoSoo Cloning Kit (purchased from Beijing Qingke Biotechnology Co., Ltd.). The connection reaction system is shown in Table 1: Table 1. Ligation reaction system The ligation product was transformed into Escherichia coli DH5α, and a single colony was picked on an LB medium plate containing apramycin (LB medium plate containing apramycin consists of the following components: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract, 50 mg apramycin, 20 g agar powder, and 1 L distilled water), and the plasmid was extracted and sequenced to obtain the recombinant vectors pSET152-scutP1-ectABCD and pSET152-scutP1-ectD. (The schematic diagram of the recombinant vector is shown in Figures 1 - 2 (as shown) the pSET152-scutP1-ectABCD plasmid was treated with XbaI restriction endonuclease and purified and recovered to obtain the pSET152-scutP1-ectABCD linearized vector.

[0064] Using the recombinant vector pSET152-scutP1-ectD as a template, the primer scutP1-Fw (5'- GGTCGACTCGG TACCA CGGCCCCTGAGCACGAA') (the underlined part indicates the homologous fragment required for seamless cloning) and ectD-Rv (5'- TCTAGAGGATCCCCAACA TCAGGCCTTGCGGCTGACG-3') (the underlined part indicates the homologous fragment required for seamless cloning and connection), and the scutP1-ectD fragment was recovered by PCR amplification and purification.

[0065] The pSET152-scutP1-ectABCD linearized vector and the scutP1-ectD fragment were seamlessly cloned and connected. The connection reagent used was TSINGKE TSV-S1 TreliefSoSoo Cloning Kit (purchased from Beijing Qingke Biotechnology Co., Ltd.). The connection reaction system is shown in Table 2: Table 2. Ligation reaction system The ligation product was transformed into Escherichia coli DH5α, and a single colony was picked on an LB medium plate containing apramycin (LB medium plate containing apramycin consists of the following components: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract, 50 mg apramycin, 20 g agar powder and 1 L distilled water), and the plasmid was extracted and sequenced to obtain the recombinant vector pSET152-scutP1-ectABCD-scutP1-ectD. (The schematic diagram of the recombinant vector is shown in Figure 3 shown) 5. Construction of recombinant Streptomyces The recombinant vectors pSET152-scutP1-ectABCD and pSET152-scutP1-ectABCD-scutP1-ectD obtained in step 4 were electrotransformed into the Escherichia coli ET12567 / pUZ8002 host, respectively, to obtain the Escherichia coli transformed strains ET / pSET152-scutP1-ectABCD and ET / pSET152-scutP1-ectABCD-scutP1-ectD. The above Escherichia coli was inoculated into LB medium containing apramycin, chloramphenicol and kanamycin (the LB medium containing apramycin, chloramphenicol and kanamycin consists of the following components: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract, 50 mg apramycin, 25 mg chloramphenicol, 50 mg kanamycin and 1 L distilled water), and cultured at 37°C and 220 rpm for 16 h with shaking. Take 4 mL of the culture medium obtained from ET / pSET152-scutP1-ectABCD and ET / pSET152-scutP1-ectABCD-scutP1-ectD, centrifuge at 6000×g for 2 min, and remove the supernatant. Resuspend the cells in 2 mL of fresh LB medium, centrifuge at 6000×g for 2 min, and remove the supernatant to remove the antibiotics in the culture.

[0066] Take 100 μL of the spore storage solution of Streptomyces SCUT-1 prepared in step 3 and stored at 4°C, incubate it at 50°C for 10 min, mix it evenly with the collected Escherichia coli transformation strains ET / pSET152-scutP1-ectABCD and ET / pSET152-scutP1-ectABCD-scutP1-ectD cells, spread it on a solid MS medium plate (the solid MS medium consists of the following components: 20 g mannitol, 20 g soybean powder, 10 mM magnesium chloride final concentration, 20 g agar powder and 1 L distilled water), and invert and culture it at 30°C for 16 h.

[0067] Take out the MS medium plate after culture. Take another 1 mL of aqueous solution containing apramycin and nalidixic acid (the aqueous solution containing apramycin and nalidixic acid consists of the following components: 1 mg apramycin, 0.5 mg nalidixic acid and 1 mL sterile water) and evenly cover it on the MS medium plate. After the plate is fully dried, place it at 37°C for 3 to 5 days. After a single colony is clearly grown on the MS medium plate, use an inoculation needle to pick up a single colony and put it into a seed liquid culture medium containing apramycin and nalidixic acid (the seed culture medium containing apramycin and nalidixic acid consists of the following components: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract, 50 mg apramycin, 25 mg nalidixic acid and 1 L distilled water), shake and culture at 37°C, 220 rpm for 48 h, take 1 mL of the cultured bacterial solution, and use the soil genomic DNA rapid extraction kit (purchased from Sangon Biotechnology Co., Ltd.) to extract genomic DNA. The extraction steps are performed according to the standard procedures in the kit manual. Use universal primers M13-47 (5'-CGCCAGGGTTTTCCCAGTCACGAC-3') and M13-48 (5'-AGCGGATAACAATTTCACACAGGA-3'), The extracted genomic DNA was used as a template for PCR verification, and Streptomyces recombinant strains were obtained, named SCUT-OectABCD and SCUT-OectABCD-OectD. SCUT-OectABCD and SCUT-OectABCD-OectD were obtained by combining E. coli transformation strains ET / pSET152-scutP1-ectABCD and ET / pSET152-scutP1-ectABCD-scutP1-ectD with SCUT-1, respectively.

[0068] Example 2 Evaluation of the ability of Streptomyces recombinant strains SCUT-OectABCD and SCUT-OectABCD-OectD to produce ectoine and hydroxyectoine: (1) The starting strain Streptomyces SCUT-1, the recombinant bacteria SCUT-OectABCD and SCUT-OectABCD-OectD obtained in Example 1 were inoculated into seed liquid culture medium (the seed culture medium consisted of the following components: 10 g of tryptone, 10 g of sodium chloride, 5 g of yeast extract and 1 L of distilled water), respectively, and cultured at 37°C and 220 rpm for 24 h to obtain Streptomyces SCUT-1 seed liquid, recombinant bacteria SCUT-OectABCD seed liquid and recombinant bacteria SCUT-OectABCD-OectD seed liquid.

[0069] (2) The seed solution of Streptomyces SCUT-1, the seed solution of recombinant bacteria SCUT-OectABCD, and the seed solution of recombinant bacteria SCUT-OectABCD-OectD were transferred to the fermentation medium (the fermentation medium consisted of the following components: 10 g of tryptone, 10 g of sodium chloride, 5 g of yeast extract, and 1 L of distilled water) at an inoculation rate of 1% of the volume of the fermentation medium, and cultured at 40°C and 220 rpm for 48 h. The culture was centrifuged at 12,000 × g and 4°C for 5 min, and the supernatant fermentation broth and bacterial cells were collected for determination of the content of ectoine and hydroxyectoine, respectively.

[0070] (3) Determination of the content of ectoine and hydroxyectoine. The specific steps are as follows: Supernatant treatment method: Take 200 µL of the collected supernatant fermentation broth of Streptomyces SCUT-1, recombinant bacteria SCUT-OectABCD, and recombinant bacteria SCUT-OectABCD-OectD, mix thoroughly with 800 µL of anhydrous ethanol, filter through a 0.22 µm organic filter membrane, and store at 4°C.

[0071] Bacteria treatment method: Resuspend Streptomyces SCUT-1, recombinant bacteria SCUT-OectABCD, and recombinant bacteria SCUT-OectABCD-OectD with 1 mL of 80% ethanol, shake at 220 rpm, 37°C in a shaker for 1 h, then centrifuge at 12000 rpm for 3 min, collect the supernatant, filter it through a 0.22 µm organic filter membrane, and store it at 4°C.

[0072] VertexTM NH2 (4.6×250 mm, 5 µm) liquid chromatography column was used to detect the contents of ectoine and hydroxyectoine in the fermentation broth. An ultraviolet (UV) detector was selected, 70% acetonitrile was selected as the mobile phase, the column temperature was 30°C, the detection wavelength was 210 nm, and the flow rate was 1.0 mL / min.

[0073] The yields of ectoine and hydroxyectoine of the starting strain SCUT-1, the recombinant strain SCUT-OectABCD, and the recombinant strain SCUT-OectABCD-OectD are as follows Figure 4As shown. The results showed that the production of ectoine and hydroxyectoine of Streptomyces SCUT-1 was 67.4 mg / L and 59.3 mg / L, respectively; the production of ectoine and hydroxyectoine of the recombinant strain SCUT-OectABCD was 250.7 mg / L and 269.0 mg / L, respectively, which were 3.7 times and 4.5 times that of the starting strain; the production of ectoine and hydroxyectoine of the recombinant strain SCUT-OectABCD-OectD was 101.3 mg / L and 513.8 mg / L, which were 1.5 times and 8.7 times that of the starting strain. The sum of the production of ectoine and hydroxyectoine of the recombinant strain SCUT-OectABCD-OectD was the highest, and this strain was selected for subsequent applications.

[0074] Example 3 Evaluation of the ability of Streptomyces recombinant strain SCUT-OectABCD-OectD to tolerate high osmotic pressure: (1) The starting strain Streptomyces SCUT-1 and the recombinant bacteria SCUT-OectABCD-OectD obtained in Example 1 were inoculated into seed liquid culture medium (the seed culture medium consisted of the following components: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract and 1 L distilled water), respectively, and cultured at 37°C and 220 rpm for 24 h to obtain the seed liquid of Streptomyces SCUT-1 and the seed liquid of the recombinant bacteria SCUT-OectABCD-OectD.

[0075] (2) The seed solution of Streptomyces SCUT-1 and the seed solution of the recombinant bacteria SCUT-OectABCD-OectD were transferred to a new LB medium (the LB medium was composed of the following components: 10 g of tryptone, 10 g of sodium chloride, 5 g of yeast extract and 1 L of distilled water) at an inoculation rate of 1% of the volume of the LB medium, and cultured at 40°C and 220 rpm for 12 h. The culture was centrifuged at 5000 rpm and 4°C for 5 min, the supernatant was removed, and the cells were rinsed twice with 1×PBS (the 1×PBS was composed of the following components: 8 g of sodium chloride, 0.2 g of potassium chloride, 1.44 g of disodium hydrogen phosphate, 0.24 g of potassium dihydrogen phosphate and 1 L of distilled water). After rinsing, the bacterial solution was centrifuged at 5000 rpm and 4°C for 5 min, the supernatant was removed, and the Streptomyces SCUT-1 and recombinant bacteria SCUT-OectABCD-OectD were transferred into LB medium containing 1.0% sodium chloride, 5.0% sodium chloride, and 7.5% sodium chloride (the LB medium was composed of the following components: 10 g of tryptone, 10 g of sodium chloride, 5 g of yeast extract, and 1 L of distilled water), and cultured at 40°C and 220 rpm for 6 days. Take 1 mL of bacterial solution every day and centrifuge it at 12000 × g at 4°C for 5 min, collect the supernatant fermentation liquid and bacterial cells for the determination of ectoine and hydroxyectoine content, and take 100 μL of bacterial solution and 100 μL of water in a 96-well ELISA plate, mix them well, and measure the absorbance at 600 nm on an ELISA reader.

[0076] (3) The specific steps for determining the content of ectoine and hydroxyectoine are shown in Example 2; Growth curves of the starting strain SCUT-1 and the recombinant strain SCUT-OectABCD-OectD and the production of ectoine and hydroxyectoine are shown in Figure 5As shown. The results showed that as the concentration of sodium chloride in the culture medium increased, the growth of Streptomyces SCUT-1 and the recombinant bacteria SCUT-OectABCD-OectD would be inhibited, but the recombinant bacteria SCUT-OectABCD-OectD showed better salinity tolerance than Streptomyces SCUT-1. The recombinant bacteria SCUT-OectABCD-OectD could grow to the stable phase faster than Streptomyces SCUT-1 in LB medium containing 5.0% sodium chloride and could also return to the stable phase in LB medium containing 7.5% sodium chloride where Streptomyces SCUT-1 could not grow normally. In addition, the production of hydroxyectoine by the recombinant bacteria SCUT-OectABCD-OectD after 6 days of culture in LB medium containing 1.0% sodium chloride, 5.0% sodium chloride, and 7.5% sodium chloride was 102.8 mg / L, 197.3 mg / L, and 132.5 mg / L, respectively, which was significantly higher than that of Streptomyces SCUT-1 at 11.8 mg / L, 111.6 mg / L, and 7.8 mg / L.

[0077] Example 4 Evaluation of the ability of Streptomyces recombinant strain SCUT-OectABCD-OectD to degrade feathers by solid-state fermentation: (1) The starting strain Streptomyces SCUT-1 and the recombinant bacteria SCUT-OectABCD-OectD obtained in Example 1 were inoculated into seed liquid culture medium (the seed culture medium consisted of the following components: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract and 1 L distilled water), respectively, and cultured at 37°C and 220 rpm for 24 h to obtain the seed liquid of Streptomyces SCUT-1 and the seed liquid of the recombinant bacteria SCUT-OectABCD-OectD.

[0078] (2) The seed liquid of Streptomyces SCUT-1 and the seed liquid of the recombinant bacteria SCUT-OectABCD-OectD were inoculated into fermentation medium with a solid-liquid ratio of 1:2.0, 1:1.75, 1:1.5, 1:1.25, 1:1.0, and 1:075 (the fermentation medium consisted of the following components: 12 g of dry feathers and 24 g, 21 g, 18 g, 15 g, 12 g, and 9 g of distilled water, respectively) at 10% of the solid mass of the fermentation medium, and cultured at 40°C for 5 days. After the fermentation was completed, the culture was placed in a 65°C oven to a constant weight, and then the dried fermentation product was dissolved in distilled water at a ratio of 1:20, placed in a shaker at 37°C and 220 rpm for 2 hours, and then centrifuged at 4°C and 12,000 × g for 5 minutes. The supernatant fermentation liquid was collected for determination of amino acid, soluble polypeptide content, and ectoine and hydroxyectoine content.

[0079] (3) Determination of amino acid content. The specific steps are as follows: Take 200 μL of the supernatant fermentation liquid in a centrifuge tube, add 50 μL of solution A, then add 50 μL of solution B, mix well and react at 90 °C for 30 min. After the reaction is completed, cool it in a 25 °C water bath, add 950 μL of distilled water, mix well and let it stand for 5 min. Then take 200 μL and use a 96-well ELISA plate to measure the absorbance value at a wavelength of 570 nm on an ELISA reader. The measured OD 570 Substitute into the standard curve and calculate the amino acid content. The standard curve is prepared by dissolving isoleucine powder in distilled water to prepare standard solutions of 0, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, and 350 μg / mL, and constructed using the same determination method as the sample to be tested.

[0080] The preparation steps of solution A are as follows: weigh 0.0907 g of potassium dihydrogen phosphate trihydrate and 4.5364 g of disodium hydrogen phosphate dodecahydrate and add them to a 200 mL volumetric flask, and add distilled water to make up to 200 mL.

[0081] The preparation steps of solution B are as follows: weigh 1 g of ninhydrin and dissolve it in a beaker containing 70 mL of hot water, add 80 mg of stannous chloride, filter, take the filtrate into a 100 mL volumetric flask and add distilled water to make up to 100 mL.

[0082] (4) Determination of soluble polypeptide content. The specific steps are as follows: The TaKaRa BCA Protein Assay Kit (purchased from Bio-Rad Biotechnology Co., Ltd.) was used for the assay, and the assay steps were performed according to the standard procedures in the kit instructions.

[0083] (5) The specific steps for determining the content of ectoine and hydroxyectoine are shown in Example 2; The amino acid and peptide recovery of feathers from solid-state fermentation of the starting strain SCUT-1 and the recombinant strain SCUT-OectABCD-OectD Figure 6The results showed that the amino acid recovery of the starting strain SCUT-1 in the fermentation medium with a solid-liquid ratio of 1:2.0, 1:1.75, 1:1.5, 1:1.25, 1:1.0, and 1:075 was 0.074 g / g, 0.113 g / g, 0.052 g / g, 0.026 g / g, 0.025 g / g, and 0.022 g / g, and the soluble polypeptide recovery was 0.315 g / g, 0.363 g / g, 0.278 g / g, 0.185 g / g, 0.184 g / g, and 0.178 g / g. The total recovery of amino acids and soluble polypeptides was 0.389 g / g, 0.476 g / g, 0.330 g / g, 0.211 g / g, 0.209 g / g, and 0.200 g / g. g / g; the amino acid recoveries of the recombinant bacteria SCUT-OectABCD-OectD were 0.172 g / g, 0.173 g / g, 0.131 g / g, 0.094 g / g, 0.055 g / g, and 0.040 g / g, respectively; the soluble polypeptide recoveries were 0.436 g / g, 0.510 g / g, 0.418 g / g, 0.360 g / g, 0.220 g / g, and 0.202 g / g, respectively; the total recoveries of amino acids and soluble polypeptides were 0.608 g / g, 0.683 g / g, 0.549 g / g, 0.454 g / g, 0.275 g / g, and 0.24 g / g, which were 1.56, 1.43, 1.66, 2.15, 1.32, and 1.20 times that of the starting strain SCUT-1, respectively.

[0084] The contents of ectoine and hydroxyectoine in feathers from solid-state fermentation of the starting strain SCUT-1 and the recombinant strain SCUT-OectABCD-OectD are as follows Figure 6 The results showed that the total amount of ectoine and hydroxyectoine in the fermentation medium of the starting strain SCUT-1 at the solid-liquid ratio of 1:2.0, 1:1.75, 1:1.5, 1:1.25, 1:1.0, and 1:075 was 1.90 g / kg, 2.11 g / kg, 2.12 g / kg, 2.09 g / kg, 0.98 g / kg, and 0.13 g / kg; the total amount of ectoine and hydroxyectoine in the recombinant strain SCUT-OectABCD-OectD was 4.90 g / kg, 6.36 g / kg, 5.08 g / kg, 4.40 g / kg, 1.65 g / kg, and 1.89 g / kg, and the total yield was 2.58, 3.01, 2.40, 2.11, 1.68, and 14.54 times that of the starting strain SCUT-1, respectively.

[0085] Example 5 Evaluation of the ability of Streptomyces recombinant strain SCUT-OectABCD-OectD to degrade cottonseed meal and shrimp shells by solid-state fermentation: (1) The starting strain Streptomyces SCUT-1 and the recombinant bacteria SCUT-OectABCD-OectD obtained in Example 1 were inoculated into seed liquid culture medium (the seed culture medium consisted of the following components: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract and 1 L distilled water), respectively, and cultured at 37°C and 220 rpm for 24 h to obtain the seed liquid of Streptomyces SCUT-1 and the seed liquid of the recombinant bacteria SCUT-OectABCD-OectD.

[0086] (2) The seed liquid of Streptomyces SCUT-1 and the seed liquid of the recombinant strain SCUT-OectABCD-OectD were inoculated into a cottonseed meal fermentation medium with a solid-liquid ratio of 1:1.5 (the cottonseed meal fermentation medium was composed of the following components: 12 g cottonseed meal, 18 g distilled water) and a shrimp shell fermentation medium with a solid-liquid ratio of 1:4.0 (the shrimp shell fermentation medium was composed of the following components: 10 g shrimp shell, 40 g distilled water) at an inoculation rate of 10% of the solid mass of the fermentation medium, and were cultured at 40°C for 3 days and 5 days, respectively. After the fermentation was completed, the culture was placed in a 65°C oven to a constant weight, and then the dried fermentation product was dissolved in distilled water at a ratio of 1:20, placed in a shaker at 37°C and 220 rpm for 2 hours, and then centrifuged at 4°C and 12,000 × g for 5 minutes. The supernatant fermentation liquid was collected for determination of amino acid, soluble polypeptide content, and ectoine and hydroxyectoine content.

[0087] (3) The specific steps for determining the amino acid content and soluble polypeptide content are shown in Example 4; (4) The specific steps for determining the content of ectoine and hydroxyectoine are shown in Example 2; The results of the determination of the amino acid and polypeptide recovery amounts of cottonseed meal and shrimp shells by solid-state fermentation of the starting strain SCUT-1 and the recombinant strain SCUT-OectABCD-OectD showed that the amino acid recovery amount of the starting strain SCUT-1 in the cottonseed meal fermentation medium with a solid-liquid ratio of 1:1.5 was 0.117 g / g, the soluble polypeptide recovery amount was 0.200 g / g, and the total recovery amount of amino acids and soluble polypeptides was 0.317 g / g; the amino acid recovery amount of the recombinant strain SCUT-OectABCD-OectD was 0.128 g / g, the soluble polypeptide recovery amount was 0.246 g / g, and the total recovery amount of amino acids and soluble polypeptides was 0.374 g / g, and the total recovery amount was 1.18 times that of the starting strain SCUT-1. The amino acid recovery amount of the starting strain SCUT-1 in the shrimp shell fermentation medium with a solid-liquid ratio of 1:4.0 was 0.150 g / g, the soluble polypeptide recovery amount was 0.142 g / g, and the total recovery amount of amino acids and soluble polypeptides was 0.292 g / g; the amino acid recovery amount of the recombinant bacteria SCUT-OectABCD-OectD was 0.155 g / g, the soluble polypeptide recovery amount was 0.180 g / g, and the total recovery amount of amino acids and soluble polypeptides was 0.335 g / g, and the total recovery amount was 1.15 times that of the starting strain SCUT-1.

[0088] The results of the determination of ectoine and hydroxyectoine content in cottonseed meal and shrimp shell by solid-state fermentation of the starting strain SCUT-1 and the recombinant strain SCUT-OectABCD-OectD showed that the total amount of ectoine and hydroxyectoine of the starting strain SCUT-1 in the cottonseed meal fermentation medium with a solid-liquid ratio of 1:1.5 was 1.59 g / kg; the total amount of ectoine and hydroxyectoine of the recombinant strain SCUT-OectABCD-OectD was 5.12 g / kg, and the total yield was 3.22 times that of the starting strain SCUT-1. The total amount of ectoine and hydroxyectoine of the starting strain SCUT-1 in the shrimp shell fermentation medium with a solid-liquid ratio of 1:4.0 was 2.93 g / kg; the total amount of ectoine and hydroxyectoine of the recombinant strain SCUT-OectABCD-OectD was 5.00 g / kg, and the total yield was 1.70 times that of the starting strain SCUT-1.

[0089] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Use of overexpression of a gene encoding synthetic ectoine and / or overexpression of a gene encoding synthetic hydroxyectoine in promoting the synthesis of ectoine and hydroxyectoine by Streptomyces, characterized in that: The coding gene for synthesizing ectoine includes ectA、ectB and ectC At least one of; The coding gene for the synthesis of hydroxyectoine is ectD .

2. The use according to claim 1, characterized in that: Gene encoding ectoine synthesis ectA The sequence is shown in SEQ ID No. 1; Gene encoding ectoine synthesis ectB The sequence is shown in SEQ ID No. 2; Gene encoding ectoine synthesis ectC The sequence is shown in SEQ ID No. 3; Gene encoding hydroxyectoine synthesis ectD The sequence is shown in SEQ ID No. 4; The streptomyces include Streptomyces SCUT-1.

3. The use according to claim 1, characterized in that: The overexpression of the coding gene for synthesizing ectoine and / or the overexpression of the coding gene for synthesizing hydroxyectoine is: ectABCD Overexpression and gene ectD Overexpression ， The gene ectABCD The sequences are SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4 connected in sequence.

4. Genes ectABCD Overexpression and gene ectD The application of overexpression in improving the tolerance of Streptomyces to hyperosmotic environment is characterized in that: The overexpression of the coding gene for synthesizing ectoine and / or the overexpression of the coding gene for synthesizing hydroxyectoine is: ectABCD Overexpression and gene ectD Overexpression ， The gene ectABCD The sequences are SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4 connected in sequence; ectD The sequence is shown in SEQ ID No. 4; the Streptomyces includes Streptomyces SCUT-1.

5. Use of overexpression of a gene encoding synthetic ectoine and / or overexpression of a gene encoding synthetic hydroxyectoine in improving the ability of Streptomyces to degrade agricultural waste, characterized in that: The coding gene for synthesizing ectoine includes ectA、ectB and ectC At least one of; The coding gene for the synthesis of hydroxyectoine is ectD ; Gene encoding ectoine synthesis ectA The sequence is shown in SEQ ID No. 1; Gene encoding ectoine synthesis ectB The sequence is shown in SEQ ID No. 2; Gene encoding ectoine synthesis ectC The sequence is shown in SEQ ID No. 3; Gene encoding hydroxyectoine synthesis ectD The sequence is shown in SEQ ID No. 4; The streptomyces include Streptomyces SCUT-1; The degradation of agricultural waste is to degrade biomass into amino acids and polypeptides.

6. The use according to any one of claims 1 to 5, characterized in that: The overexpression is performed by using an overexpression promoter scutP1, and the nucleic acid sequence of the promoter scutP1 is shown in SEQ ID No.

5.

7. A recombinant Streptomyces bacterium, characterized in that: Contains a recombinant vector; the recombinant vector contains a promoter scutP1; the recombinant vector also contains a gene ectABCD ; The gene ectABCD The sequence is SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4 connected in sequence; The nucleic acid sequence of the promoter scutP1 is shown in SEQ ID No.5; In the recombinant vector, the nucleic acid sequence of the promoter scutP1 is connected to the gene ectABCD ; The original strain of the recombinant Streptomyces bacteria includes Streptomyces SCUT-1.

8. The Streptomyces recombinant bacterium according to claim 7, characterized in that The recombinant vector also contains a gene ectD , the gene ectD The sequence is shown in SEQ ID No.4; In the recombinant vector, the nucleic acid sequence of the promoter scutP1 is connected to the gene ectABCD The sequence of the promoter scutP1 is then connected to the nucleic acid sequence of the gene ectD sequence.

9. Use of the recombinant Streptomyces bacteria according to claim 7 or 8 in degrading agricultural waste.

10. The use according to claim 9, characterized in that: The following steps are involved: Inoculating the recombinant Streptomyces bacteria according to claim 7 or 8 into a fermentation medium, and fermenting; The fermentation medium uses agricultural waste as the only carbon source and nitrogen source.

Images