3 results about "Trionyx" patented technology

The invention provides a specific primer for trionychidae sex identification and a detection method thereof. The specific primer comprises a forward primer 5 'GGTGATGGTGGTACTGGTAAAAC3'and a reverse primer 5' GCAGACCACCAAATTTCCTG3 ', and the forward primer 5' GGTGATGGGTGGTACTGTAAAAC3 'and the reverse primer 5' GCAGACCACCAAATTTCCTG3 'are The method for carrying out sex identification by using the primer comprises the following steps: extracting genome DNA of a trionychidae individual to be detected; carrying out PCR (Polymerase Chain Reaction) amplification by adopting the specific primer; and carrying out electrophoresis detection on the amplified product, judging that the amplified product is male when only 250bp bands appear, and judging that the amplified product is female when 250bp and 600bp bands appear at the same time. The method is suitable for sex determination and PCR amplification system and program parameter optimization of trionychidae animals such as Chinese softshell turtles, horns and apalone ferox, and 1.5% agarose gel electrophoresis detection is adopted. The invention also provides a trionychidae animal sex identification kit containing the primer pair, and the invention provides a rapid, accurate, simple and convenient trionychidae animal sex identification method, which can be applied to the breeding and cultivation management of trionychidae animals, and has high commercial value.

1. Name of the designed product: medicine box (soft-shelled turtle). 2. Use of the designed product: for storing and managing medicine. 3. Design points of the designed product: in shape. 4. Picture or photo best indicating the design points: perspective view.

The utility model provides a juvenile trionyx sinensis screening device, and relates to the technical field of juvenile trionyx sinensis screening, the juvenile trionyx sinensis screening device comprises a middle vibration screening frame, an upper screen frame and a lower water collecting box, the upper portion of the middle vibration screening frame is fixedly connected with the upper screen frame, the lower water collecting box is arranged below the middle vibration screening frame, the two sides of the upper screen frame are fixedly provided with side connection sliding frames, and the side connection sliding frames are connected with the middle vibration screening frame. A first lifting screw is rotatably arranged on the inner side of the side connecting sliding frame and connected with the tail end of the middle baffle in a threaded fit mode, a middle transverse water pipe is rotatably arranged on the front side of the middle baffle in a matched mode through a rotating shaft, and water spraying nozzles are arranged on the front portion of the middle transverse water pipe at intervals in an array mode. The friction force between the juvenile soft-shelled turtles and the upper screen frame and the friction force between the juvenile soft-shelled turtles and the middle vibration screening frame are reduced through the lubricating effect of water flow, the situation that the juvenile soft-shelled turtles are abraded and damaged through screen holes of the upper screen frame is reduced, and the problem that the juvenile soft-shelled turtles are easily damaged due to abrasion with the screen holes of the screen in the screen moving process is solved.