Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cycloartane type triterpene compound and application thereof

A technology of cycloaltin-type and triterpene compounds, which is applied in the field of pharmaceutical compounds and can solve the problems of few reports on plant compound screening

Inactive Publication Date: 2015-04-22
KUNMING UNIV OF SCI & TECH +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In particular, there are few reports on the application of this system to the screening of plant compounds.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cycloartane type triterpene compound and application thereof
  • Cycloartane type triterpene compound and application thereof
  • Cycloartane type triterpene compound and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Separation and extraction of cycloaltin-type triterpenoids KY24 and KY41

[0029] In September 2008, Yunnan cohosh was collected from Yangla Township, Daocheng County, Sichuan Province ( Cimicifuga yunnanensis 1.5Kg of the above-ground part sample, the plant species name was identified by researcher Qiu Minghua of Kunming Institute of Botany, and the crude drug specimens are deposited in the State Key Laboratory of Phytochemistry and Western Plant Resources Sustainable Utilization of Kunming Institute of Botany, Chinese Academy of Sciences (KUN No. 200809007).

[0030] Crush 1.5Kg of the aerial part of Cimicifuga yunnanensis, soak and extract with 95% methanol (5L) at room temperature for 3 times, each time for 1 day; combine the extracts, concentrate under reduced pressure at 50°C until no methanol is evaporated, and obtain 137.8g of extract ; The extract was mixed with 250 g of silica gel, subjected to normal pressure forward silica gel (2000 g) column c...

Embodiment 2

[0047] Example 2: Antitumor Activity Experiment of Cycloaltin-type Triterpenoids KY24 and KY41

[0048] 1. Construction of screening cells: wild-type mice were used as carriers, and p53 gene-deleted mouse embryonic fibroblasts (p53 - / - cells) to construct mouse tumor cells (p53 - / - +S+Ras, p53 - / - +V+Ras), the specific steps are as follows:

[0049] (1) Construction of vectors for Ras mutant genes and vectors expressing p53S mutant genes

[0050] For the construction method of the vector, see the method in patent ZL200910095184.3, that is, the p53S or Ras mutant gene cDNA is connected into the PQCXIP vector (purchased from Invitrogen) by conventional genetic engineering methods, and the p53S or Ras sequence constructed in the vector is sequenced For verification, the constructed vector is used in p53 - / - The p53S or Ras mutant gene is introduced into the cells.

[0051] (2) Transfection of p53S or Ras mutant gene vector

[0052] (a) Preparation of phoenix cells

[0...

Embodiment 3

[0065] Example 3: Compound activation experiment of tumor suppressor gene p16 activity

[0066] 1. The construction of p16-GFP-reporting vector, the specific method is as follows:

[0067] (1) The green fluorescent protein GFP reporter gene was excised from the pAcGFP1-N1 plasmid (purchased from Clontech) using BgLII and NotI double enzyme digestion, and the Luciferase reporter gene in pGL4.82 (purchased from Promega) was replaced to produce pGL4- GFP vector;

[0068] (2) Design primers for the promoter region of the p16 gene (5'GCTCGAGGATGAAAATTACCCTCC3', 5'GGATCTCTTTTCCTCGCGGAGAT3') to amplify the promoter sequence and connect it into the pGL4-GFP vector, thus obtaining a reporter vector fused with the p16 gene promoter and GFP -- ---p16-GFP-reporter vector.

[0069] 2. The reporter vector fused with the p16 gene promoter and GFP was transferred into mouse fibroblasts (MEF). The specific method is as follows: (1) Extract the plasmid with the TIANGEN BIOTECH plasmid extra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cycloartane type triterpene compound with a novel structure and an application thereof in preparing an anti-tumor medicine. The result of targeted screening of tumor specific mutant gene products indicates that the cycloartane type triterpene compound has anti-tumor activity against the tumor cells carrying tumor specific mutant genes p53 and Ras and does not have or only has low cytotoxic activity against normal cells, wherein KY41 can activate the cancer suppressor gene p16; and the characteristic indicates that the cycloartane type triterpene compound and a medicinal composition taking the same as an effective treatment dose have application potential in preparing individual-based treatment medicines for the tumor specific mutant genes p53 and Ras and the cancer suppressor gene p16.

Description

technical field [0001] The invention belongs to the field of pharmaceutical compounds, in particular to novel cycloaltin-type triterpene compounds KY24 and KY41 isolated and extracted from the aerial part of Yunnan Cimicifuga (Cyunnanensis), and their application in the preparation of antitumor drugs or their application in tumor personalized targeted medical technology in the application. Background technique [0002] Tumor is a kind of fatal disease that seriously threatens human health. Its pathogenesis has not been fully elucidated, and the treatment effect is not satisfactory. Most of the drugs currently routinely used in tumor therapy are designed for the regulation of DNA replication or cytoskeleton in the process of cell proliferation. While these drugs kill rapidly proliferating tumor cells, they are also highly toxic to normal proliferating cells (such as bone marrow stem cells, etc.) On the contrary, the resistance of the tumor decreases, and it is difficult to ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07J71/00A61K31/585A61P35/00
Inventor 张继虹邱明华唐文如年寅罗瑛王海燕朱晖陆思千贾舒婷吴晓明
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com