A kind of thermophilic laccase and engineering bacteria, recombinant laccase and application

A technology of engineering bacteria and laccase, applied in the field of environmental biology and biology, can solve the problems of high cost and poor effect, and achieve the effect of good heat and alkali resistance and high tolerance

Active Publication Date: 2017-02-01
SOUTH CHINA UNIV OF TECH
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most industrial dyes are difficult to be degraded by microorganisms, and the use of physical or chemical methods is often costly and ineffective

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of thermophilic laccase and engineering bacteria, recombinant laccase and application
  • A kind of thermophilic laccase and engineering bacteria, recombinant laccase and application
  • A kind of thermophilic laccase and engineering bacteria, recombinant laccase and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Synthesis of Novel Laccase Gene

[0030] Based on the GenBand: YP_005641270.1 amino acid sequence published on the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov / ), the sequence is based on the codon preference of Pichia pastoris Optimization was carried out to obtain a novel laccase gene whose sequence is shown in SEQ ID NO.1, which was synthesized by a biotechnology company (Nanjing KingScript Biotechnology Co., Ltd.), and the synthesized gene was cloned in the pUC57 plasmid (purchased from Kings Rui Biological Technology Co., Ltd.) to obtain the plasmid pUC57-lacTT.

Embodiment 2

[0032] Construction of Recombinant Plasmid pHKFA1-lacTT Containing Novel Laccase Gene and E.coli Top10 / pHKFA1-lacTT Carrying the Plasmid

[0033] Design PCR primers according to the nucleotide sequence of the novel laccase gene: forward primer TTF: 5'-G GAATTC AATACCGATAGAAGAACCCT-3' (underlined EcoRI restriction site) and reverse primer TTR: 5'-ATTT GCGGCCGC TTAGTGGTGGTGGTGGTGGTGGTGGTG TCCGACTTCCAAAACTCC-3' (the underline is the NotI restriction site, which also contains 8×His tag and stop codon).

[0034] The plasmid pUC57-lacTT in Example 1 was used as a template, and TTF and TTR were used as primers for PCR amplification. The gel-recovered and purified PCR product was double-digested with restriction endonucleases EcoRI and NotI, and ligated with the plasmid pHKFA1 that had also been double-digested with EcoRI and NotI with T4 ligase overnight at 16°C, and the ligated product was chemically transformed into E.coli Top10 (purchased from Invitrogen Life Technology Co., L...

Embodiment 3

[0036] Construction of a Novel Laccase-producing Strain Pichia pastoris GS115 / pHKFA1-lacTT and Expression of Recombinant Laccase

[0037]The recombinant plasmid pHKFA1-lacTT was linearized and purified by Kpn2I single enzyme digestion, and then electrotransformed into Pichiapastoris GS115 (purchased from Invitrogen Life Technologies Co., Ltd., USA) competent cells, and positive transformants were screened on MD plates. The transformant screened on the MD plate was used as a template, and TTF and TTR were used as primers for PCR identification. The correct transformant identified by PCR was initially identified as a new laccase-producing strain Pichia pastoris GS115 / pHKFA1-lacTT.

[0038] Pick 3 transformants identified correctly by PCR and inoculate them into BMGY medium, and culture them at 30°C and 250rpm until OD 600 Close to 6.0, collect the cells by centrifugation at 6000rpm, 4°C for 5min, and then resuspend the collected cells in BMMY medium (containing 0.1mM CuSO 4 ) t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Thermus thermophilus laccase, engineering bacteria, recombinant laccase and application thereof. The amino acid sequence of the Thermus thermophilus laccase is shown in Seq No.2. The DNA sequence encoding the above laccase is shown in Seq No.1. The DNA can be used in constructing a Pichia pastoris expression system. The recombinant Pichia engineering strain is obtained by linearizing the expression vector pHKFA1-lacTT and then transforming Pichia pastoris. The recombinant laccase is obtained by fermenting the above-mentioned recombinant Pichia pastoris engineered bacteria. The recombinant laccase has laccase activity and high temperature resistance, and can be used in the decolorization of dyes, especially the decolorization of azo dyes and anthraquinone dyes, and the decolorization rate can even reach 100%.

Description

technical field [0001] The invention relates to the fields of biotechnology and environmental biology, in particular to a thermophilic bacteria laccase gene and the application of the genetically engineered bacterium and the laccase coded by the gene in biological enzymatic treatment of textile wastewater. Background technique [0002] Laccase (benzenediol:oxygen oxidoreductases, EC1.10.3.2) is a copper-containing polyphenol oxidase, which belongs to the family of blue multicopper oxidases (MCOs), and is widely distributed in plants, fungi, a few bacteria and insects. The active center of laccase generally contains 4 copper ions. The catalyzed oxidation reaction of laccase is to transfer electrons through the cooperation between copper ions, capture the electrons of the reaction substrate, oxidize the substrate into a free radical form, and capture the free radical from the substrate at the same time. electrons are passed to O 2 , will O 2 Revert to water. Laccase acts on...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/81C12N1/19C02F3/00C12R1/84
CPCC12N9/0061C12N15/815C12Y110/03002C02F3/34C12N15/81C12N1/165C12R2001/84
Inventor林影刘慧平梁书利韩双艳郑穗平
OwnerSOUTH CHINA UNIV OF TECH