Unlock instant, AI-driven research and patent intelligence for your innovation.

Antigen for detecting porcine epidemic diarrhea virus neutralizing antibody and its preparation method and application

A porcine epidemic diarrhea and antigen technology, applied in the field of genetic engineering, can solve problems such as biological safety hazards, and achieve the effects of easy follow-up pilot test and expanded production, large output, and easy commercialization

Active Publication Date: 2017-05-17
SUN YAT SEN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, using the whole PEDV virus as the coating antigen has biological safety hazards

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antigen for detecting porcine epidemic diarrhea virus neutralizing antibody and its preparation method and application
  • Antigen for detecting porcine epidemic diarrhea virus neutralizing antibody and its preparation method and application
  • Antigen for detecting porcine epidemic diarrhea virus neutralizing antibody and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] 1. Amplification of PEDV S1 and partial S2 gene segmented recombinant genes

[0039] (1) Partial S gene segmentation strategy of PEDV and its synthesis

[0040] According to the prediction of the S protein signal peptide by the software, the signal peptide needs to be removed when segmented expression. According to the principle of differential segmentation of identified antigen regions of PEDV, the PEDVS1 and part of the S2 gene are divided into 7 segments, which are named SP1-SP7 respectively. The nucleotide sequences of the SP1-SP7 are shown in SEQ ID NO: 1-7, respectively. The amino acid sequences of SP1-SP7 are shown in SEQ ID NO: 8-14 respectively (see Table 1). At the same time, SP5-SP7 also serves as a complementary interface. The above seven fragments all added a His tag gene at the 3' end.

[0041] Table 1 Nucleotide sequence and amino acid sequence of SP1-SP7

[0042]

[0043] (2) PEDV RNA extraction and RT-PCR

[0044] The extraction of PEDV RNA was ...

Embodiment 2

[0096] 1. Amplification of the SP4 gene

[0097] The content of this part is basically the same as that of Example 1, only the SP4-specific primers are different. The restriction sites of the upstream and downstream primers of SP4 in Example 1 were exchanged to obtain SP4F' and SP4R' in this example to meet the requirements of the downstream restriction sites of the eukaryotic expression plasmid pFastBacDualp10 promoter. The sequence of the SP4F' is: GCCTCGAGATGAGTATTAGGACAGAATATTTACAGCTT, and the sequence of the SP4R' is: GCGGTACCACTATACATATGAAGCTTCTCAGCGTC.

[0098] 2. Construction of eukaryotic expression plasmid expressing SP4 gene and synthesis of recombinant protein in insect cell sf9

[0099] (1) Construction of a recombinant plasmid expressing the SP4 gene

[0100]For the eukaryotic expression plasmid pFastBacDual (Invitrogen) digestion, ligation, and large-scale preparation of recombinant plasmids, see the process of prokaryotic expression vector construction in Exa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an antigen for detecting a porcine epidemic diarrhea virus (PEDV) neutralizing antibody, and a preparation method and an application thereof. The antigen has the nucleotide sequence shown in SEQ ID NO:4. A PEDV main surface antigen S protein is subjected to piecewise expression in an in-vitro expression system, 7 purified polypeptide antigens are obtained, and 1 polypeptide antigen is selected from the 7 purified polypeptide antigens and can be used for detecting the PEDV neutralizing antibody. The invention discloses an application of the antigen in preparation of a reagent for detecting the PEDV neutralizing antibody. The antigen is produced by adopting the mature expression system, and is large in yield, prone to subsequent pilot scale test and expandable production, and prone to commercialization.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to an antigen for detecting porcine epidemic diarrhea virus neutralizing antibodies, a preparation method and application thereof. Background technique [0002] Porcine epidemic diarrhea (Porcine epidemic diarrhea; PED) first broke out in 1971 in British pigs and fattening pigs, and its pathogen was porcine epidemic diarrhea virus (Porcine epidemic diarrhea virus; PEDV). PEDV and porcine transmissible gastroenteritis virus (Transmissible gastroenteritis virus; TGEV), cat coronavirus, canine gastroenteritis virus and human coronavirus 229E belong to group 1 of the genus Coronaviridae in the Coronaviridae family. According to reports, the natural host of the virus is only pigs, and it has also been reported that PEDV can be adapted to mouse passage and has neurovirulence in mice. PEDV mainly causes diarrhea in medium and large pigs. It was discovered in 1976 that the disease can al...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/165C12N15/50G01N33/68G01N33/569
CPCC07K14/005C12N2770/20022G01N33/56983G01N33/68G01N2333/165
Inventor 曹永长郝健伟薛春宜
Owner SUN YAT SEN UNIV