Unlock instant, AI-driven research and patent intelligence for your innovation.

A method for identifying rice elephants, corn elephants and grain elephants

A corn weevil and corn weevil technology, which is applied in the identification of rice weevil, corn weevil and corn weevil, can solve the problems of time-consuming, laborious and cost-consuming, and achieve the effect of simplifying technical steps, important theoretical significance and application value, and simple and quick operation.

Inactive Publication Date: 2019-07-19
SHANGHAI PASSION BIOTECHNOLOGY CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The method of molecular identification is time-consuming and costly through two steps of amplification and sequencing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for identifying rice elephants, corn elephants and grain elephants
  • A method for identifying rice elephants, corn elephants and grain elephants
  • A method for identifying rice elephants, corn elephants and grain elephants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0023] The following examples are to further illustrate the present invention, rather than limit the present invention.

[0024] 1. Design of specific primer pairs for identification of rice elephant, corn elephant and valley elephant

[0025] Based on the fragments of the measured rice elephant, corn elephant and valley elephant COI gene, design the specific primer pairs that can identify rice elephant, corn elephant and valley elephant as follows:

[0026] The specific primer pair for identification of Miele is as follows:

[0027] SO-GSP1-2F:ATCAGGAATAGTAGGTACATC;

[0028] SO-GSP1-3R: AGAGGAGGAGAATAGCAGTGATTCTT.

[0029] The specific primer pairs for identifying maize elephants are as follows:

[0030] SZ-GSP1-2F:GTTCTGATTACTCCCTCCATCA;

[0031] SZ-GSP1-2R: AATCAACAGAGGCTCCTTCGTGT.

[0032] The specific primer pair for identification of the valley elephant is as follows:

[0033] SG-GSP1-F: TGGAACCTCTTTAAGACTATTAATTCGA;

[0034] SG-GSP1-R: AGGTGGGTAAACTGTTCACCCTGTTCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for rapidly identifying Sitophilus oryzae, Sitophilus zeamais and Sitophilus granarius. The method is characterized in that on the basis of acquiring COI (Cytochrome C Oxidase Subunit I) gene sequences of the Sitophilus oryzae, the Sitophilus zeamais and the Sitophilus granarius, a non-homologous region among the COI gene sequences is found; three pairs of specific primers are designed according to the sequences in the non-homologous region; the Sitophilus oryzae, the Sitophilus zeamais and the Sitophilus granaries are distinguished according to the absence and presence of finally-obtained electrophoretic bands or the differences among the sizes of the electrophoretic bands after amplification of these specific primers. By adopting the method, the conventional classification and identification steps are simplified, and the problems of high sequencing cost and the like are solved; a provided PCR (Polymerase Chain Reaction) primer method can increase the identification efficiency and accuracy of the Sitophilus oryzae, the Sitophilus zeamais and the Sitophilus granarius, is easy, convenient and rapid to operate, is suitable for identifying the Sitophilus oryzae, the Sitophilus zeamais and the Sitophilus granarius, and has an important theoretical meaning and an application value.

Description

technical field [0001] The invention belongs to the field of applied biotechnology, and in particular relates to a method for identifying rice elephants, corn elephants and grain elephants. Background technique [0002] Rice elephant (Sitophilus oryzae) is a small black beetle in rice valley, commonly known as grub. The main host is in various stored grains such as corn, rice, wheat, sorghum, and flour. There are also more families with wooden floors. [0003] Corn weevil (Sitophilus zeamais) is the number one pest of stored grain in China and also an important pest of stored grain worldwide. Corn weevils are borer pests. Adults feed on cereal seeds, as well as stored goods such as flour, oil plants, and botanical medicinal materials. Wheat, corn, brown rice, and sorghum are the most severely damaged; larvae only damage cereal seeds. [0004] Rice elephants are very similar in appearance to corn elephants. The main difference is that there is no longitudinal groove on th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888
CPCC12Q1/6888
Inventor 陈升张燕丁方美孙子奎
Owner SHANGHAI PASSION BIOTECHNOLOGY CO LTD