Unlock instant, AI-driven research and patent intelligence for your innovation.

A dna barcode and its application of Mogonia mongolica

A naked-bellied flea and barcode technology, applied in the field of species identification, can solve problems such as difficulty, heavy dependence on professional background of species classification, misjudgment, etc., and achieve the effect of breaking through excessive dependence.

Active Publication Date: 2021-06-15
GUANGDONG LAB ANIMALS MONITORING INST
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In order to solve the existing problems of morphological-based identification of Mogonia, such as difficulty, cumbersome process, heavy reliance on the professional background of species classification, and frequent misjudgments, the present invention provides a DNA barcode of Mogonia, and a A rapid detection method for the germplasm of Diadia mongolica, in order to realize the rapid and accurate identification of Diadia mongolica

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 The DNA barcode of Mogolia mongolica

[0028] Through research, the present invention has determined the DNA barcode standard detection gene sequence of Daphnia mongolica, which is mitochondrial 16s rDNA (Moi-16s), and the specific sequence is:

[0029] 5’-AAAGTAAATAGCCGCAGTATTTTGACTGTGCTAAGGTAGCATAATCATTAGTCTTTTAATTGAAGGCTGGTATGAAGGGCAAGACGAGAAAGAAGCTGTCTCTACTTAAATTTTTTGAATTTCATTTTTTAGTGCAAAAGCTAAAATATTTTTAAAGGACGATCAGACCCTATGGAGTTTAAAATTTTAGTAATTACGAATTAACTTTATATAATTGTAACTAATAAAATTTTTTGTTGGGGCGACAGAAAGATAAAAATAACACTTTCTTAAACAAACTAAGATAAAAGAATAATTGATCCCTTAAGAAGGATTACAAGACTAAGTTACCCTAGGGATAACAGCGTAATCTTTTTGGAGAGTTCATATCGATAAAAAGGTTTGCGACCTCGATGTTGGATTAAGAA-3’(SEQ ID NO:1)。

Embodiment 2

[0030] Embodiment 2 A kind of identification method of Mogna mongolica

[0031] Using the method of the present invention, the Daya Bay population of Nada mongolica is identified.

[0032] (1) Molybdenum mongolica was collected in Daya Bay, Shenzhen City, Guangdong Province, and DNA was extracted from a single individual.

[0033] Sample pretreatment: the collected samples were rinsed with 0.9% normal saline.

[0034] The blood / cell / tissue genomic DNA extraction kit from Tiangen Biological Company was used for DNA extraction, and the DNA was dissolved in sterile water. Determination of OD of sample DNA by UV spectrophotometer 260 、OD 280 value, determine its concentration and purity, and store the mother liquor at -20°C.

[0035] (2) Synthesize mitochondrial 16s rDNA (16s) primers; the primers used in this embodiment are as follows:

[0036] Moi-F: 5'-TACTGCCTGCTCAATGCTTA-3' (SEQ ID NO: 2);

[0037] Moi-R: 5'-GAACTGCTACACCCCATCAAG-3' (SEQ ID NO: 3).

[0038] (3) PCR amp...

Embodiment 3

[0044] Embodiment 3 A kind of identification method of Mogna mongolica

[0045] Utilize the method of the present invention to identify the population of Daphnia mongolica introduced into Shanghai Ocean University.

[0046] (1) Diaphragma mongolica was collected and introduced in Shanghai Ocean University, and DNA was extracted from a single one.

[0047] Sample pretreatment: the collected samples were rinsed with 0.9% normal saline.

[0048] The blood / cell / tissue genomic DNA extraction kit from Tiangen Biological Company was used for DNA extraction, and the DNA was dissolved in sterile water. Determination of OD of sample DNA by UV spectrophotometer 260、OD 280 value, determine its concentration and purity, and store the mother liquor at -20°C.

[0049] (2) Synthesize mitochondrial 16s rDNA (16s) primers; the primers used in this embodiment are as follows:

[0050] Moi-F: 5'-TACTGCCTGCTCAATGCTTA-3' (SEQ ID NO: 2);

[0051] Moi-R: 5'-GAACTGCTACACCCCATCAAG-3' (SEQ ID NO: 3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a DNA barcode, a pair of primers and a germplasm identification method for Diadia mongolica. The method extracts the Moi-16s gene by extracting the Moi-16s DNA, and then utilizes DNA barcode primers to amplify the Moi-16s gene by polymerase chain reaction. The PCR product is sequenced and sequence compared, and if the homology between the sequence of the sample to be tested and the gene sequence Moi-16s is more than 99%, it can be determined that the sample to be tested is Mogonia mongolica. The method has high accuracy, strong reliability, and simple operation, which ensures the safety of the introduction of Daphnia mongolica.

Description

technical field [0001] The invention relates to the field of species identification, in particular to a DNA barcode of Diadia mongolica and an application thereof. Background technique [0002] Moina mongolica belongs to Diplostraca, Cladocera, Moinidae, and Moina. It is native to inland saline waters. Its excellent growth and reproduction and artificial breeding characteristics have now become an important aquatic economic animal bait; because of its good sensitivity to pollutants, it has been widely used in ecotoxicity tests and has become the national standard GB / T 18420.2-2009 "Offshore oil Recommended test organisms for Exploration and Development Contaminants Biological Toxicity Part 2: Test Methods". [0003] Since the genus Moina to which Mogonia belongs is numerous, the individuals are small, and the similarity between individuals within the genus is very high, and affected by the complexity of the water body in the natural environment, the body color and so on oft...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/166
Inventor 黄韧蔡磊李建军陈小曲魏远征苗宗余余露军
Owner GUANGDONG LAB ANIMALS MONITORING INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More