A kind of dna bar code standard detection method and its application of identifying giant clam

A barcode and clam technology, applied in recombinant DNA technology, DNA/RNA fragments, biochemical equipment and methods, etc., can solve problems such as difficult to accurately identify clam, achieve automation and standardization, break through excessive dependence, and quickly price Effect

Active Publication Date: 2020-12-22
OCEAN UNIV OF CHINA
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved by the present invention is to provide a DNA barcode standard detection method for identifying giant clams and its application in view of the deficiencies in the prior art, so as to solve the problem that it is difficult to accurately identify giant clams based on external morphology and manual experience. The rapid and effective identification of Tridacna is of great significance for the study of species classification, phylogeny, phylogeography and protection of Tridacna germplasm resources.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of dna bar code standard detection method and its application of identifying giant clam
  • A kind of dna bar code standard detection method and its application of identifying giant clam
  • A kind of dna bar code standard detection method and its application of identifying giant clam

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Screening of DNA barcodes of Tridacnaceae shellfish

[0036] 1) The sequence used to screen the DNA barcodes of Tridacnaceae molluscs:

[0037] Query the mitochondrial gene sequences of Tridacnaceae shellfish on the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov / ), among which there are 2028 CO1 sequence records; 192 16s rRNA records; 122 18s rRNA records; 3 12s rRNA records. Among them, 12s rRNA only contains two species of giant clam (Tridacnasquamosa) and giant clam (T.maxima), which do not meet the conditions for DNA barcodes.

[0038] After analysis, the CO1 gene sequence of the following species was obtained: (Hippopus hippopus), giant clam (T.derasa), giant clam (T.gigas), giant clam (T.maxima), scaled clam (T.squamosa), saffron clam (Tridacna crocea) . Among them, 10 sequences (HE995483.1-HE995487.1, FM244530.1-FM244534.1) were downloaded from giant clam (T.maxima) and 10 sequences from giant clam (T.squamosa) (H...

Embodiment 2

[0086] Example 2: Universal primer pairs for amplifying the above DNA barcodes

[0087] 1) Sequence alignment: use BioEdit software to align (Hippopus hippopus), giant clam (T.derasa), giant clam (T.gigas), giant clam (T.maxima), scaled giant clam (T.squamosa), saffron giant clam (Tridacna crocea) Compare the CO1 sequences to find the sequence fragments that are relatively conservative and have the least base variation.

[0088] 2) Primer synthesis: According to the above comparison results, a pair of amplification primers was designed in the sequence fragment with the smallest base variation by using the primer design software Primer5. The primer sequence is

[0089] COI-F: 5'CTACTCCACCCGCTACCAAT 3' (SEQ ID NO: 7);

[0090] COI-R: 5'GATGCTCTACAATGTGCGAAAC 3' (SEQ ID NO: 8).

[0091] 3) Primer amplification: the above-mentioned amplification primers were respectively applied to PCR amplification of known giant clam samples. Set the PCR thermal cycle annealing temperature...

Embodiment 3

[0095] The shellfish collected from Quanfu Island in the South China Sea is preliminarily determined to be a type of giant clam from the appearance observation, but it is not clear which species it belongs to. The barcodes obtained by screening of the present invention are used for identification.

[0096] Specific steps are as follows:

[0097] 1) Utilize conventional method to extract the DNA of the sample to be tested for use;

[0098] 2) PCR amplification: use the designed degenerate primers to perform PCR amplification on the individuals of Tridacnaceae to be tested. The annealing temperature range is 48-52°C;

[0099] 3) Sequencing results: the amplified product is subjected to two-way sequencing; the determined nucleotide sequence is:

[0100] AAATCAAAATAAATGTATAAATAAAACCGGATCTCCACCGCCAACAGGATCAAAAAATGATGTAGCAAAATTACGATCAAATAATAATATGGTTAAAGCCCCAGCTAAAACAGGCATTGCCACAATAAGAAGCAACGCTGTAATACCTAATGACACTGGAAACATAGGAATTTTATGGAAACCACGTTTTTGATGCCGTATATTAGCCACAGTCCTTGCAAAATTTA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a DNA bar code combination for identifying tridacna. The DNA bar code combination comprises a DNA bar code for identifying hippopus, of which a nucleotide sequence is SEQ ID NO:1, a DNA bar code for identifying phosphate-free tridacna, of which a nucleotide sequence is SEQ ID NO:2, a DNA bar code for identifying tridacna gigas, of which a nucleotide sequence is SEQ ID NO:3, a DNA bar code for identifying tridacna maxima, of which a nucleotide sequence is SEQ ID NO:4, a DNA bar code for identifying phosphate tridacna, of which a nucleotide sequence is SEQ ID NO:5, and a DNA bar code for identifying tridacna crocea, of which a nucleotide sequence is SEQ ID NO:6. The invention also provides a universal primer pair for amplifying the tridacnidae shellfish DNA bar codes, and sequences of primers of the primer pair are SEQ ID NO:7 and SEQ ID NO:8. The bar codes and the amplification primers provided by the invention can effectively identify specific categories of the tridacna.

Description

technical field [0001] The invention belongs to the technical field of shellfish molecular markers, and in particular relates to a DNA barcode standard detection method for identifying giant clams and an application thereof. Background technique [0002] The family Tridacnidae belongs to Bivalvia, Heterodonta, and Veneroida. It is a large bivalve mollusk that mainly lives in tropical seas, coral reefs or seas. sand surface. Tridacnaceae shellfish have delicious meat, high nutritional and medicinal value, and are expensive. Their processed products have extremely high artistic value and have been overfished all over the world. In recent years, some countries have listed three species of giant clam (Tridacna gigas) as rare and protected animals in the world for protection. Tridacna maxima is also listed as Near Threatened on the IUCN Red List. At present, 9 species of Tridacnaidae have been discovered. Different species can be distinguished according to the distribution of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6888C12Q1/6869C12N15/11
CPCC12Q1/6869C12Q1/6888C12Q2531/113C12Q2563/185C12Q2565/125
Inventor郑小东姜典航曾晓起张晓英李琪
OwnerOCEAN UNIV OF CHINA