LAMP (Loop-mediated Isothermal Amplification) detection kit and method of pathogenic aeromonas hydrophila

Abstract

The invention relates to an LAMP (Loop-mediated Isothermal Amplification) detection kit of pathogenic aeromonas hydrophila, having convenient use and rapid detection. The LAMP detection kit comprises a bacterium DNA extracting reagent and an LAMP reaction reagent, wherein the reaction reagent contains primers FIP with the sequence of GTTTCCCCCATCAGATCCGTGGTTTACGCCACCCAGTTTCTTG, BIP with the sequence of TCCGGCCTGTATACCTGTATCAGGTTAAACCAGGGTGTCATCGCT, F3 with the sequence of TGATGGCCACGAGACATCCA and B3 with the sequence of TGCTTGATCCCCTTGCTACT. The LAMP detection method of the pathogenic aeromonas hydrophila comprises the following steps of: (1) DNA (Deoxyribonucleic Acid) extraction; (2) LAMP amplification of the pathogenic aeromonas hydrophila; and (3) staining detection. The invention is suitable for detecting the pathogenic aeromonas hydrophila.

Description

technical field

[0001] The invention relates to a detection technology of a target DNA fragment, in particular to a kit and a detection method for rapid detection of pathogenic Aeromonas hydrophila by using a loop-mediated isothermal amplification (Loop-mediated isothermal amplification, LAMP) technology. Background technique

[0002] Aeromonas hydrophila (Aeromona hydrophila) is an opportunistic pathogenic bacterium that widely exists in water and soil, and can cause systemic sepsis or Local infection often leads to a large number of animal deaths, and can also cause human sepsis, meningitis and enteritis diarrhea. Aeromonas hydrophila is an acute infectious disease pathogen that harms the most species of fish in the history of fish farming in my country, the most widespread area, the longest epidemic season, the most types of fish farming waters, and the most serious losses. Since it became popular across the country in the 1990s, many aquaculture animals can be infected ...

Images