Check patentability & draft patents in minutes with Patsnap Eureka AI!

SCAR (Sequence-characterized Amplified Regions) primers and method for identifying tobacco varieties

A technology for labeling primers and varieties, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve problems affecting the quality and style of cloud-produced cigarettes, wrong labeling, and mixed varieties

Inactive Publication Date: 2012-07-25
ZHENGZHOU UNIVERSITY OF LIGHT INDUSTRY
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since different tobacco leaf varieties play different roles in cigarette formulations, the subsequent identification of tobacco leaf varieties needs to be resolved urgently
So far, the identification of differences between varieties is limited to the evaluation of the appearance quality of tobacco leaves, especially in the process of tobacco leaf production, purchase, re-baking, and storage. A scientific tracking and monitoring system has not been formed, resulting in a series of mixed varieties , Mislabeling and other phenomena have seriously affected the stability of the quality and style of cloud-produced cigarettes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SCAR (Sequence-characterized Amplified Regions) primers and method for identifying tobacco varieties
  • SCAR (Sequence-characterized Amplified Regions) primers and method for identifying tobacco varieties
  • SCAR (Sequence-characterized Amplified Regions) primers and method for identifying tobacco varieties

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0030] A SCAR marker primer for identifying tobacco varieties, using RAPD to analyze 12 tobacco varieties, and obtain 6 specific fragments, design 6 pairs of SCAR primers based on the nucleotide sequences of the 6 specific fragments, and the 12 tobacco varieties are safflower Dajinyuan, K326, NC102, NC297, Yunyan 85, Yunyan 87, Yunyan 97, China Tobacco 100, Cuibi 1, KRK26, Longjiang 911 and Nanjiang 3, the six pairs of SCAR primers are:

[0031] S1-F: GTCCACACGGGGCAATTAATG /

[0032] S1-R: GTCCACACGGCTATGAGATTA, the PCR product size is 545bp;

[0033] S2-F: CACGGCTGCGTGTTATGAAC /

[0034] S2-R: CACGGCTGCGAAGAGCTAAG, the PCR product size is 733bp;

[0035] S3-F: CAATCGCCGTAAATACACAAAAGTA /

[0036] S3-R: AATCGCCGTCAGGAGAGAGA, the PCR product size is 887bp;

[0037] S4-F: CCACAGCAGTAACAGGAGGA /

[0038] S4-R: CCACAGCAGTCTGATATTGGATG, the PCR product size is 313bp;

[0039] S5-F: AGGCTGTGCTATTGTAGGATGAGAC /

[0040] S5-R: AGGCTGTGCTTACTGCTTCTAC, the PCR product size is 555bp; ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses SCAR (Sequence-characterized Amplified Regions) marker primers and method for identifying tobacco varieties. According to the invention, twelve tobacco varieties are analyzed by RAPD (Random amplified polymorphic DNA) to obtain 6 specific fragments, and the 6 pairs of SCAR marker primers are designed on the basis of the nucleotide sequences of the 6 specific fragments. The12 tobacco varieties are as follows: Honghua Dajinyuan, K326, NC102, NC297, Yunyan85, Yunyan87, Yunyan97, China tobacco 100, flue-cured tobacco, KRK26, LJ (Long River) 911 and Nanjiang No.3. According to the invention, the method for applying SCAR markers to identification on the tobacco varieties is established; and an SCAR finger-print library for the 12 tobacco varieties is established. The method disclosed by the invention can be applied to not only field identification on cigarette raw materials, but also identification on initially-dried and redried tobacco leaves or leaf blades, so that an SCAR marking technology is successfully applied to industrial production of tobaccos.

Description

technical field [0001] The invention relates to a method for identifying tobacco varieties with SCAR markers. It belongs to the field of tobacco biotechnology. Background technique [0002] After the separation of industry and commerce, a large number of flue-cured tobaccos in Yunnan and the single and aging varieties of flue-cured tobaccos have made the original raw material advantages of cloud-produced cigarettes gradually disappear, resulting in the homogeneity of product styles between cloud-produced cigarette brands and brands outside the province. Raw materials have become one of the bottlenecks that seriously restrict the development of cigarettes produced in the cloud. The implementation of the raw material differentiation project of Hongyun Honghe Group started from the two aspects of new variety selection and foreign variety introduction at the same time, which improved this situation to a certain extent. However, since different tobacco leaf varieties play diffe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor 马林王绍坤常寿荣罗华元王超饶智罗昭标董石飞胡战军林昆毛华
Owner ZHENGZHOU UNIVERSITY OF LIGHT INDUSTRY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More