Sphingomonas alginate lyase gene ZH0-II as well as prokaryotic expression vector and application thereof

The technology of alginate lyase and ZH0-II is applied in the application field of preparing alginate lyase ZH0-II protein, and can solve the problems of difficult separation of enzymes and degradation products, low enzyme production by wild bacteria and high production costs, Achieve broad substrate specificity

Inactive Publication Date: 2014-07-30
KUNMING UNIV OF SCI & TECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are many types of alginic acid decomposing bacteria found at home and abroad, mainly distributed in marine bacteria, soil bacteria and fungi, etc., but they have been successfully cloned and heterologously expressed There are not many alginate lyases in the world. The traditional method generally uses sodium alginate decomposing bacteria to separate and purify alginate lyase through fermentation. This method has low enzyme production in wild bacteria, and it is difficult to separate enzymes from degradation products. Production The problem of high cost has become a restrictive technical problem for enzymatic hydrolysis technology to prepare a large number of alginate oligosaccharides, which limits the popularization and use of alginate lyase, and most alginate lyase can only use PloyG or PloyM alone. The present invention starts from The alginate lyase gene ZH0-II was successfully cloned from Sphingomonas ZH0, and the research on heterologous expression and protein purification was carried out. The recombinant alginate lyase ZH0 obtained in the present invention -II has a wide range of substrate specificity, and can use both PloyG and PloyM as substrates. It is a bifunctional enzyme with broad application prospects. The present invention is to further study the molecular mechanism of alginate lyase, and then extend it to industry laying the foundation for production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sphingomonas alginate lyase gene ZH0-II as well as prokaryotic expression vector and application thereof
  • Sphingomonas alginate lyase gene ZH0-II as well as prokaryotic expression vector and application thereof
  • Sphingomonas alginate lyase gene ZH0-II as well as prokaryotic expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Sphingomonas Sphingomonas Preparation and detection of sp. ZH0 genomic DNA

[0040] Sphingomonas used in the present invention Sphingomonas sp. ZH0 (ZH0) is the strain screened by our laboratory. Genomic DNA of Sphingomonas ZH0 was prepared by the extraction method of common bacterial genome. Use up the supernatant and collect the bacteria; add 100ul Solution I suspension bacteria, then add 30ul 10%SDS; 1ul 20mg / ml proteinase K, mix well, and incubate at 37°C for 1 hour; add 100ul 15mol / L NaCl, mix well; add 20ul CTAB / NaCl solution (CTAB 10%, NaCl 0.7mol / L), mix well, 65°C, 10 minutes; add an equal volume of phenol / chloroform / isoamyl alcohol 25:24:1) and mix well, centrifuge at 12000rpm for 5 minutes; Take the supernatant, add 2 times the volume of absolute ethanol, 0.1 times the volume of 3mol / L NaOAC, and place it at -20°C for 30 minutes; centrifuge at 12000rpm for 10 minutes; add 70% ethanol to the precipitate to wash; after the precipitate is drie...

Embodiment 2

[0041] Example 2: Alginate Lyase Gene ZH0-II Amplification and TA cloning:

[0042] alginate lyase gene ZH0-II Amplification and TA cloning strategies such as figure 2 As shown, a pair of specific primers were designed according to the conserved sequence of the N-terminal and C-terminal of Sphingomonas alginate lyase, the sequence is as follows:

[0043] ZH0-2-F: GGATCCGCACCGGCCGCAGCGCACTCGGCC

[0044] ZH0-2-R: GCGGCCGCTCAGCTCGAGTGCTTTACGTGGAG

[0045] The primer at the 5' end has the GGATCC characteristic sequence, which forms a BamH I restriction site; the 3' end adds a GCGGCC characteristic sequence to form a Not I restriction site;

[0046] Add 10ng of Sphingomonas ZH0 genomic DNA as a template to the PCR reaction mixture, and add 50ng of specific primers ZH0-2-R and ZH0-2-F, 1.8uldNTP (10mM), 2.5ul of Pfu Reaction buffer and 0.15ul pfu (5U / ul) polymerase (Beijing Zhuangmeng International Biogene Technology Co., Ltd.), add double distilled water to make the final vo...

Embodiment 3

[0047] Example 3: Prokaryotic expression vector pGEX-4T-1- ZH0-II build

[0048] pGEX-4T-1- ZH0-II A build strategy such as Figure 4 As shown, the purified prokaryotic expression vectors pGEX-4T-1 (purchased from GE Healthcare) and pMD19- ZH0-II , separated the cleaved vector and insert fragments by agarose gel electrophoresis, and recovered the vector fragments pGEX-4T-1 (4.9kb) and pMD19- ZH0-II produced by cutting ZH0-II The DNA fragment (0.7kb) of the gene, and then use the ligase kit of TaKaRa to connect the pGEX-4T-1 vector fragment and ZH0-II The DNA fragment of the gene produces the prokaryotic expression vector pGEX-4T-1- ZH0-II , converting the high efficiency (10 8 ) Escherichia coli competent cells (JM109, Beijing Zhuangmeng International Biogene Technology Co., Ltd.), spread the transformed Escherichia coli on the plate of ampicillin (Amp, 100ug / ml), and cultivate overnight at 37°C , screen Amp-resistant recombinant colonies, and extract plasmids from Amp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a sphingomonas alginate lyase gene ZH0-II and its prokaryotic expression vector pGEX-4T-1-ZH0-II for highly expressing the alginate lyase ZH0-II, which is activated by Ptac coli to control its expression in Escherichia coli, the present invention uses the Escherichia coli expression vector to express the alginate lyase gene, the expression product alginate lyase ZH0-II can be obtained in a relatively short period of time, and the obtained recombinant alginate lyase Enzyme ZH0-II has broad substrate specificity, can use both PloyG and PloyM as substrates, and its enzyme activity can reach 61.7U / mg. The prokaryotic expression vector and overall expression system of the present invention are easy to operate and convenient for industrial production.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering, in particular to a sphingomonas alginate lyase gene ZH0-II and its prokaryotic expression vector pGEX-4T-1- ZH0-II and its application in preparing alginate lyase ZH0-II protein. Background technique [0002] In recent years, due to the aggravation of the energy crisis and the increasingly prominent environmental problems, more and more attention has been paid to the production of bioenergy from seaweed biomass. Macroalgae are rich in carbohydrates, such as alginic acid, and the corresponding technology can be developed to convert it into bioethanol with high yield and easy pretreatment. At present, the methods of alginic acid degradation can be divided into three categories: one is the chemical degradation method, and the acid hydrolysis method is widely used at present. This method has cumbersome operation steps and severe reaction conditions. In addition, there is hydrogen perox...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/60C12N15/70C12N9/88C12R1/01
Inventor伊日布斯过敏钱龙赵琳唐丽薇严金平
OwnerKUNMING UNIV OF SCI & TECH