Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Quantitative comparison method for detecting fragile X syndrome based on methylation level and primer used in quantitative comparison method

A technology for X chromosome and syndrome, which is applied in the field of detection of congenital genetic defect Fragile X chromosome syndrome, can solve the problems of inability to realize quantitative detection and immature method for quantitative detection of abnormal methylation of FMR1 promoter

Inactive Publication Date: 2015-04-08
绍兴迪安华因生物科技有限公司
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] The technical problem to be solved by the present invention is to provide a stable and rapid method for detecting Fragile X syndrome and the primers used by quantitatively comparing the methylation levels of CpG islands; the method of the present invention can solve the quantitative detection of FMR1 promoter abnormalities so far The method of methylation is still immature, especially the defect that the quantitative detection of a single CpG site cannot be realized

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quantitative comparison method for detecting fragile X syndrome based on methylation level and primer used in quantitative comparison method
  • Quantitative comparison method for detecting fragile X syndrome based on methylation level and primer used in quantitative comparison method
  • Quantitative comparison method for detecting fragile X syndrome based on methylation level and primer used in quantitative comparison method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0095] Example 1: Patient A with suspected fragile X syndrome.

[0096] 1. Obtain clinical samples and set up experimental and control groups

[0097] 1) Patient

[0098] The sample of male patient A came from a tertiary hospital, clinically manifested as mental retardation, and the preliminary diagnosis of big ears was Fragile X syndrome.

[0099] 2) Control group

[0100] Three normal men and three normal women were selected as the control group.

[0101] 2. Experimental scheme and steps

[0102] 1. Primer design: such as figure 1 As shown in a, the CpG island transcriptional regulatory region within the 300 to 100 bp region upstream of exon 1 of the FMR1 gene is selected as the methylation detection region, and the sequence is as follows figure 1 As shown in b. Amplification primers were designed for regions that do not involve CpG sites, in order to avoid amplification bias due to unknown methylation levels. The downstream amplification primers need to be labeled ...

Embodiment 2

[0149] Example 2: Patient B with suspected fragile X syndrome.

[0150] Detect according to the method described in Example 1, and the detection results are as follows:

[0151] 1. Pyrosequencing experiment results ( Figure 5 )

[0152] Each shaded area represents a CpG site, the percentage of C and T on the upper end represents the amount of the two nucleotides detected, and the ratio of C represents the proportion of methylation at this site. There are 5 ABCDE sites in total. Figure 5 a shows that the methylation levels of 5 ABCDE sites in suspected patient B are 58%, 65%, 66%, 73%, and 63%, respectively. Figure 5 b shows that the normal male control ABCDE5 methylation levels are 26%, 29%, 32%, 34%, 31%.

[0153] 2. Statistical analysis, data collation list.

[0154]

[0155] 3. Statistically analyze the above data using chi-square test, the results are as follows:

[0156] A(chi-square) B(chi-square) C(chi-square) D(chi-square) E(chi-square) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for setting a primer used in a detection method of abnormal methylation of upstream CpG island of fragile X chromosome syndrome FMR1 gene. The designed position of an amplification primer does not cover any CG dinucleotide to ensure that PCR amplification treated by a hydrosulphite has no bias. The method is specifically as follows: a pair of amplification primers designed for the upstream CpG island area of the FMR1 gene: PyroAF: TGAGTGTATTTTTGTAGAAATGGG, PyroAR: TCTCTCTTCAAATAACCTAAAAAC. The invention further provides a method for detecting fragile X syndrome by quantitatively comparing the methylation level of the CpG island stably and quickly. By adopting the method, the defects that the existing method for quantitatively detecting abnormal methylation of a FMR1 promoter is still not mature and especially cannot achieve quantitative detection of a single CpG site are solved.

Description

technical field [0001] The invention relates to the detection of congenital genetic defect Fragile X syndrome (FXS), which belongs to the field of molecular biology and clinical diagnosis of genetic diseases. Quantitative detection of chemical levels. Background technique [0002] The fragile X chromosome refers to the Xq27-q28 region of the X chromosome with a filamentous secondary constriction and a satellite structure at the end, so this part is prone to breakage, so it is called a fragile site. The disease caused by this abnormal X chromosome is called fragile X syndrome, which is the second largest hereditary mental retardation syndrome after congenital stupidity, and the inheritance method is X-linked inheritance. The main clinical manifestations are language development delay, mental retardation (IQ30-50), facial abnormalities: long face, big ears, large and protruding mandible, accompanied by aggressive behavior and autism. The disease is more common in males (the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6883C12Q1/6869C12Q2600/154C12Q2523/125C12Q2535/122C12Q2565/301
Inventor 祁鸣翁琛
Owner 绍兴迪安华因生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com