33 results about "Aberrant methylation" patented technology

The present invention provides a method for detecting pancreatic carcinoma in a subject. The method includes contacting a nucleic acid-containing specimen from the subject with an agent that provides a determination of the methylation state of at least one gene or associated regulatory region of the gene and identifying aberrant methylation of regions of the gene or regulatory region, wherein aberrant methylation is identified as being different when compared to the same regions of the gene or associated regulatory region in a subject not having the pancreatic carcinoma, thereby detecting pancreatic carcinoma in the subject.

Methods are provided for treating patients with epigenetic diseases, especially those associated with aberrant DNA methylation such as hematological disorders and cancer. By administering a DNA methylation inhibitor to the patients following unique dosing regimens, the disease can be efficaciously treated with reduced toxic side effects.

A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or “nested” polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

The invention belongs to the technical field of biomedicine. Based on the fact that the abnormal methylation of genes are involved in the generation and development of tumors, the invention aims to overcome the defects of a methylation sensitive restriction enzyme method, a bisulfite sequencing method and a methylation specificity PCR (Polymerase Chain Reaction) method, and provide a methylation quantitative detection method of the PCDH8 (Protocadherin-8) gene, with simple and convenient operation and high sensitivity. The detection method comprises the steps of: taking pancreatic cancer tissues, extracting DNA to prepare a standard curve sample of ACTB (Actin, Beta), and preparing a standard curve sample of PCDH8; extracting the DNA of a tissue to be detected, carrying out chemical decoration, designing a methylation primer and a probe for a CPG island in a human PCDH8 gene promoter area, and designing a BSP primer and a probe for a CPG island in a human reference gene ACTB promoter area, carrying out real-time quantitative PCR on the DNA subjected to the sulfite treatment by using a Taqman-MGB real-time quantitative PCR method, and calculating out a quantitative value on the methylation degree of a PCDH8 gene. The method has the advantages of rapidness, correctness and high sensitivity.

The present invention provides a method for analysis methylation patterns in DNA and identifying aberrantly methylated genes in disease tissue. The invention also provides a method of identifying novel targets for therapeutic intervention and disease markers. Novel cancer targets are provided.

The invention is directed to a method of diagnosing a cell proliferative disorder of breast tissue by determining the methylation status of nucleic acids obtained from a subject. Aberrant methylation of several genes including TWIST, HOXA5, NES-1, retinoic acid receptor beta (RARβ), estrogen receptor (ER), cyclin D2, WT-1, 14.3.3 sigma, HIN-1, RASSF1A, and combinations of such genes serve as markers of breast malignancy.

Methods for detecting the methylation status of a target genomic locus are provided. Methods described allow for simultaneous assay of multiple cytosines in a target genomic locus. Assays of multiple cytosines in a target genomic locus provide detection of an aggregate cytosine methylation state of the target genomic locus. Methods to detect methylation of a genomic locus associated with a disease or disorder characterized by aberrant methylation of the genomic locus, such as, but not limited to, Fragile X mental retardation syndrome, Prader-Willi syndrome, Angelman sydrome, Beckwith-Wiedemann syndrome, and Russell-Silverman syndrome, diabetes, cancer, multiple sclerosis or schizophrenia are described herein.

The present invention provides a method for detecting a cellular proliferative disorder in a subject. The method includes contacting a nucleic acid-containing specimen from the subject with an agent that provides a determination of the methylation state of at least one gene or associated regulatory region of the gene and identifying aberrant methylation of regions of the gene or regulatory region, wherein aberrant methylation is identified as being different when compared to the same regions of the gene or associated regulatory region in a subject not having said cellular proliferative, thereby detecting a cellular proliferative disorder in the subject.

This application describes methods and compositions for detecting and treating C6Orf150-associated neoplasia. Differential methylation of the C6Orf150 nucleotide sequences has been observed in C6Orf150-associated neoplasia such as colon neoplasia.

Compositions and methods are provided for facilitating the enrichment of single-stranded DNA containing methylated CpG in a mixture containing methylated and unmethylated DNA. The compositions relate to methylation-binding protein domains that selectively bind to methylated single strand DNA. In embodiments of the invention, the methylated DNA is eluted in 0.4M-0.6M NaCl while the unmethylated single strand DNA is eluted in less than 0.4M salt. The ability to readily enrich for methylated DNA permits high throughput sequencing of the methylated DNA and identification of abnormal methylation patterns associated with disease.

The invention belongs to the technical field of biomedical sciences. Abnormal methylation of genes participates in the development of tumors. The invention aims at overcoming the defects of a methylation-sensitive restrictive endonuclease method, a bisulfite sequencing method and a methylation-specific PCR (Polymerase Chain Reaction) method and provides a methylated quantitative detection method of a GSH2 (glutathione 2) gene, which has simple and convenient operation and high senibilitiy. The method comprises the following steps of: taking pancreatic cancer tissues, extracting DNA and preparing an ACTB (Actin, Beta) standard curve sample, and preparing a GSH2 (Glutathione 2) standard curve sample by utilizing a full methylation template; extracting DNA of tissues to be detected, and carrying out chemical modification; designing methylation primers and probes aiming at CPG islands at a human GSH2 gene promoter region, designing BSP (Bisulfite) primers and probes aiming at CPG islands at a human reference gene ACTB promoter region, carrying out real-time quantitive PCR on DNA after bisulfite treatment by adopting a Taqman-MGB real-time quantitive PCR method, and calculating a quantitive value of the GSH2 gene methylation degree. The method is rapid, accurate and high in sensitivity.

The invention discloses a method for setting a primer used in a detection method of abnormal methylation of upstream CpG island of fragile X chromosome syndrome FMR1 gene. The designed position of an amplification primer does not cover any CG dinucleotide to ensure that PCR amplification treated by a hydrosulphite has no bias. The method is specifically as follows: a pair of amplification primers designed for the upstream CpG island area of the FMR1 gene: PyroAF: TGAGTGTATTTTTGTAGAAATGGG, PyroAR: TCTCTCTTCAAATAACCTAAAAAC. The invention further provides a method for detecting fragile X syndrome by quantitatively comparing the methylation level of the CpG island stably and quickly. By adopting the method, the defects that the existing method for quantitatively detecting abnormal methylation of a FMR1 promoter is still not mature and especially cannot achieve quantitative detection of a single CpG site are solved.

The present invention provides a method for detecting a cellular proliferative disorder in a subject. The method includes contacting a nucleic acid-containing specimen from the subject with an agent that provides a determination of the methylation state of at least one gene or associated regulatory region of the gene and identifying aberrant methylation of regions of the gene or regulatory region, wherein aberrant methylation is identified as being different when compared to the same regions of the gene or associated regulatory region in a subject not having said cellular proliferative, thereby detecting a cellular proliferative disorder in the subject.

Compositions and methods are provided for facilitating the enrichment of single-stranded DNA containing methylated CpG in a mixture containing methylated and unmethylated DNA. The compositions relate to methylation-binding protein domains that selectively bind to methylated single strand DNA. In embodiments of the invention, the methylated DNA is eluted in 0.4M-0.6M NaCl while the unmethylated single strand DNA is eluted in less than 0.4M salt. The ability to readily enrich for methylated DNA permits high throughput sequencing of the methylated DNA and identification of abnormal methylation patterns associated with disease.

The present invention provides a method for analysis methylation patterns in DNA and identifying aberrantly methylated genes in disease tissue. The invention also provides a method of identifying novel targets for therapeutic intervention and disease markers. Novel cancer targets are provided.

The invention belongs to the technical field of biomedicine. The abnormal methylation of the gene participates in the occurrence and the development of tumors, therefore, the invention aims at overcoming the defects of a methylation sensitive restriction enzyme method, a bisulfite sequencing method and a methylation specificity PCR method, and providing a quantitative detection method of HPP1 genemethylation with convenient operation and high sensitivity. The method comprises the steps of: taking pancreatic cancer tissue; extracting NDA to prepare a standard curve sample of ACTB; using a fullmethylated template to prepare a standard curve sample of HPP1; extracting the DNA of tissue to be tested, and chemically modifying; designing methylated primer and probe by aiming at the human HPP1gene promoter area CPG island; designing BSP primer and probe by aiming at the human reference gene ACTB promoter area CPG island; conducting real-time and quantitative polymerase chain reaction (PCR)to the DNA of processed sulfite by means of Taqman-MGB real-time quantitative PCR method; and counting the quantitative value of the HPP1 gene methylation degree. The method is fast and accurate, andhas high sensitivity.

A diagnostic or prognostic assay is disclosed for a disease of condition characterized by abnormal methylation of cytosine at side or sites within the glutathione-S-transferase (GST) Pi gene and / or its regulatory flanking sequences (e.g., prostate cancer and liver cancer). The assay comprises: (i) isolating DNA from said subject, and (ii) determining (e.g., by selective PCR amplification) the presence of abnormal methylation of cytosine at a site or sites within the GST-Pi gene and / or its regulatory flanking sequences.

Provided herein is a method for distinguishing an aberrant methylation level for DNA from a first cell type, including steps of (a) providing a test data set that includes (i) methylation states for a plurality of sites from test genomic DNA from at least one test organism, and (ii) coverage at each of the sites for detection of the methylation states; (b) providing methylation states for the plurality of sites in reference genomic DNA from one or more reference individual organisms, (c) determining, for each of the sites, the methylation difference between the test genomic DNA and the reference genomic DNA, thereby providing a normalized methylation difference for each site; and (d) weighting the normalized methylation difference for each site by the coverage at each of the sites, thereby determining an aggregate coverage-weighted normalized methylation difference score. Also provided herein are sensitive methods for using genomic DNA methylation levels to distinguish cancer cells from normal cells and to classify different cancer types according to their tissues of origin.

Provided are DNA methylation related markers for diagnosis of tumors and application thereof. Disclosed are gene sequence regions having abnormal DNA methylation in the genome, named tumor markers CTSM-4F, CTSM-2BE, CTSM-3C, CTSM-4I. The methylation levels of those sequence regions are significantly different between tumor tissues and non-tumor tissues, with their CpG(s) hypermethylated in tumor tissues.