Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

33 results about "Cpg island methylation" patented technology

CpG island methylation is a mechanism of gene silencing, and concordant methylation of multiple CpG islands as CpG island methylator phenotype (CIMP) has been described in tumors. The aim of this study was to evaluate CIMP in carcinoid tumors and PETs.

Methods and compositions for assessing CpG methylation

Methods and compositions for assessing CpG island methylation are provided. Specifically, the invention provides an unstructured nucleic acid (UNA) oligonucleotide that base pairs with, i.e., hybridizes to, CpG islands. The subject oligonucleotide may be present in an array, and find use in methods for evaluating methylation of CpG islands in cells. Kits and computer programming for use in practicing the subject methods are also provided.
Owner:AGILENT TECH INC

Materials and methods for assaying for methylation of CpG islands associated with genes in the evaluation of cancer

Provided are methods, reagents, and kits for evaluating cancer, such as prostate cancer, in a subject. Disclosed methods of evaluating cancer include methods of diagnosing cancer, methods of prognosticating cancer and methods of assessing the efficacy of cancer treatment. The methods include assaying a biological sample for methylation of a CpG island associated with specified genes. Provided reagents and kits include primers suitable for amplifying at least a portion of a target CpG islands associated with specified genes.
Owner:EUCLID DIAGNOSTICS

Method for detecting methylated CpG islands

The present invention provides new and improved assay for detection of genomic methylated CpG islands. This new method is termed the methylated-CpG island recovery assay (MIRA). In accordance with one embodiment, MIRA comprises the steps of: (a) incubating genomic DNA fragments with a methylated CpG island binding protein in the presence of a binding partner for the binding protein to produce bound DNA containing methylated CpG islands, (b) isolating the bound DNA, and (c) detecting CpG island methylation by gene-specific amplification reactions. In accordance with a preferred embodiment, MIRA comprises the steps of: (a) incubating sonicated genomic DNA with a matrix containing a fusion protein of glutathione S-transferase (GST) and MBD2b (GST-MBD2b) in the presence of MBD3L1 to produce bound DNA containing methylated CpG islands, (b) eluting bound DNA from the matrix, and (c) detecting CpG island methylation by gene-specific amplification reactions.
Owner:CITY OF HOPE

Primers, method and kit for detecting secreted frizzled-related protein (SFRP)2 gene CpG island methylation

The invention discloses primers, method and kit for detecting secreted frizzled-related protein (SFRP)2 gene CpG island methylation. The primers include specific primers for amplifying deoxyribonucleic acid (DNA) segments of three CG loci (related to intestinal cancer) on an SFRP2 gene CpG island from a sample nucleic acid, and primers for pyrosequencing the obtained nucleic acid segments. By the primers, the method and the kit disclosed by the invention, the frequency of the SFRP2 gene methylation related to colorectal cancer susceptibility can be detected by adopting a pyrosequencing technique, so as to screen out susceptible people with early colorectal cancer. The primers, the method and the kit are good in specificity, and high in accuracy, and can detect samples at high flux.
Owner:郑州艾迪康医学检验所(普通合伙)

Method for detecting methylated CpG islands

The present invention provides new and improved assay for detection of genomic methylated CpG islands. This new method is termed the methylated-CpG island recovery assay (MIRA). In accordance with one embodiment, MIRA comprises the steps of: (a) incubating genomic DNA fragments with a methylated CpG island binding protein in the presence of a binding partner for the binding protein to produce bound DNA containing methylated CpG islands, (b) isolating the bound DNA, and (c) detecting CpG island methylation by gene-specific amplification reactions. In accordance with a preferred embodiment, MIRA comprises the steps of: (a) incubating sonicated genomic DNA with a matrix containing a fusion protein of glutathione S-transferase (GST) and MBD2b (GST-MBD2b) in the presence of MBD3L1 to produce bound DNA containing methylated CpG islands, (b) eluting bound DNA from the matrix, and (c) detecting CpG island methylation by gene-specific amplification reactions.
Owner:CITY OF HOPE

Kit for morbidity-related tumor suppressor gene epigenetic mutation detection of gastrointestinal neoplasms and application thereof

The invention relates to a kit for morbidity-related tumor suppressor gene epigenetic mutation detection of gastrointestinal neoplasms and application thereof. The kit mainly comprises 25 pairs of gastrointestinal neoplasm morbidity-related tumor suppressor gene promotor region CpG-island amplification and sequencing primers of 9 kinds and a polymerase chain reaction (PCR) amplification reagent. Through a PCR amplification product obtained through the kit, a gene CpG-island methylation state can be analyzed through the methods of methylation specific PCR (MSP), combined bisulphite-restrictionanalysis (COBRA) or bisulfite sequencing PCR (BSP) and the like. The kit has the efficient effect of detecting CpG-island methylation and is used for the morbidity-related tumor suppressor gene epigenetic mutation detection of the gastrointestinal neoplasms.
Owner:NANJING UNIV

CpG insular methylation test reagent kit and its application

The present invention relates to gene determining technology and is especially CpG insular methlation test reagent kit and its application for diagnosing tumor and screening demethylation medicine. The reagent kit includes primer, medicine for extracting template DNA, medicine for modifying genome, medicine for purifying DNA, specific MSP-PCR reaction system and negative and positive contrast samples. The present invention utilizes human gene sequences and designs primer based on base mismatch principle, and different gene primer is selected to constitute different reagent kit for detecting different diseases. The present invention may be used widely in the diagnosis of cancer and the screening of relevant medicine.
Owner:JINAN UNIVERSITY +2

Colorectal cancer polygene methylation joint detection test kit and application thereof

The invention discloses a colorectal cancer polygene methylation joint detection test kit and application thereof, and belongs to the technical field of molecular biology. The test kit provided by theinvention provides primers and probes for CpG island methylation detection of SEPT9, SDC2, SFRP2, NDRG4, SPG20 and FBN1 genes, and gene methylation detection is carried out by adopting a bisulfite fluorescent quantitative PCR method. The test kit provides an effective means and basis for evaluating the potential possibility of colorectal cancer, and has a wide application prospect.
Owner:山东龙奥生物技术有限公司

Kit and method for predicting hepatocarcinogenesis risk

The invention relates to a kit and a method for predicting a hepatocarcinogenesis risk, relating to the technical field of medical in-vitro diagnosis. Particularly, the invention relates to a kit anda method for predicting a hepatocarcinogenesis risk through the CpG island methylation states of single genes or multiple genes in SCT, NFIX, IGF2, ABCG5, GSTO2, SARDH, E2F6, SHANK2, GATA4, OPLAH, NR2F1 and ZFHX3. According to the combined methylation detection of the multiple genes, the sensitivity is greatly improved; the free nucleic acids of saliva, urine, blood and the like are detected, drawing materials from cancer tissue is not required, the detection is noninvasive, and the operation is simple and convenient.
Owner:北京旌准医疗科技有限公司

Fecal DNA quantitative methylation specific PCR detection kit and applications thereof

InactiveCN104694637AMicrobiological testing/measurementStool dnaFeces
The invention relates to a fecal DNA quantitative methylation specific PCR detection kit and applications thereof. The kit comprises (1) three pairs of amplification primers for the quantitative methylation of colon tumor incidence related CpG-islands in a cancer suppressor gene promoter region and three probes; and (2) a PCR reagent for amplification. A PCR amplification product obtained through the kit can analyze the methylation status of gene CpG-islands through a (quantitative methylation specific PCR, qMSP) PCR method. The kit has an efficient CpG-island methylation detection effect. The kit is applicable to the epigenetic mutation detection of colon tumor incidence related cancer suppressor genes in faeces.
Owner:NANJING HOSPITAL OF T C M

Kit for carrying out early warning and screening on liver cancer

ActiveCN105420370ASave DNA amountSave timeMicrobiological testing/measurementDomain familyP16 gene
The invention belongs to the field of molecular biology (tumor screening), particularly relates to a technology for carrying out early warning and screening on liver tumor, and aims to solve the technical problem to provide a new choice for early prediction of the liver tumor. The technical scheme of the invention is that a kit for carrying out early warning and screening on liver tumor comprises a primer which is used for amplifying the following genes of an RASSF1A (Ras-association Domain Family 1A) gene of which a promoter is in a CpG island methylation state, a p16 gene, ELF (Embryonic Liver Fodrin), an SOCS (Suppressors of Cytokine Signaling)-3 gene, an SFRP1 (Secreted Frizzled-Related Protein 1) gene and a genome repetitive sequence LINE1 (Long Interspersed Nuclear Elements 1). According to the kit disclosed by the invention, a new effective inspection method is provided for carrying out early warning and screening on early liver tumor and liver cirrhosis; the cost is low, the use is very convenient, the flexibility is high, the specificity is good, and the application prospect is very good.
Owner:SICHUAN UNIV

Construction method and detection method of trace fragmented DNA methylation detection library

The invention discloses a construction method and detection method of a trace fragmented DNA methylation detection library. The library construction method of the present invention comprises: linkingfragmented DNA to a methylation linker, wherein all cytosines on the methylation linker are methylated cytosines, the methylation linker includes a long chain and a short chain which are complementaryto form a double chain, and the long chain includes a sequencing platform universal sequence, a single molecule tag sequence, a sample tag sequence and a sequencing primer binding sequence; and the DNA linked with the methylation linker is treated with sodium bisulphate, so that the cytosine C in a non-methylated CpG island is converted into uracil U; and a specific primer and a universal primerare used for PCR amplification enrichment of a target region subjected to sodium bisulfite treatment and containing a CpG site to be detected, so that a library available for on-machine sequencing isobtained. According to the invention, methylation of trace DNA taken through liquid biopsy can be detected, and the CpG island methylation status of multiple regulatory regions of multiple tumor suppressor genes can be quantitatively detected simultaneously.
Owner:GENETALKS BIO TECH CHANGSHA CO LTD

MGMT promoter methylation detection primer and detection method thereof

InactiveCN108570504APredict therapeuticPredict prognosisMicrobiological testing/measurementDNA/RNA fragmentationMgmt promoter methylationCpg island methylation
The invention belongs to the technical field of gene detection, and provides a primer for detecting the methylation level of a promoter area of an MGMT gene and a detection method of the primer. Sequencing is conducted by adopting a pyrosequencing method, the ratio of methylation and non-methylation of a CpG island in a target area is efficiently detected, and the methylation level of the MGMT promoter area is evaluated, so that the purposes of predicating the prognosis of a patient with glioma and making individualized chemotherapy and medication plan are achieved.
Owner:上海润达榕嘉生物科技有限公司

Kit for detecting cervical carcinoma and detection method

The invention belongs to the field of medicine, and particularly provides a kit for detecting cervical carcinoma and a detection method. The genes of SOX1, PAX1, LMX1A, NKX6-1, WT1 and ONECUT1 are tumor suppressor genes related to the cervical carcinoma, and the methylation of CpG islands of promoter sites of the genes is one of main reasons for the inactivation of the genes. In the kit and the detection method, a patient can be clearly determined whether to suffer from the cervical carcinoma or not by detecting the methylation of the CpG islands of the promoter sites of the genes of SOX1, PAX1, LMX1A, NKX6-1, WT1 and ONECUT1 respectively and detecting whether HPV-L1 exists or not, the methylation of the genes is treated in advance and outcome is detected by using the HPV-L1 proteins, so that the actual conditions of cervical canceration and outcome of the patient can be perfectly evaluated in terms of molecular level, treatment is effectively guided, and misdiagnosis, over-treatment and missed diagnosis in the conventional treatment of the cervical carcinoma can be further avoided.
Owner:张秀茹

Method for detecting mycoplasma pneumonia (MP) of sheep

The invention which belongs to the technical field of biological detection relates to a method for detecting MP of sheep and provides the methylation state of CpG islands in an MBL (mannan-binding lectin) gene promoter region related with the MP of sheep and an application thereof. The invention also provides a method for detecting the MP of sheep and concretely relates to the methylation detection of the MBL promoter region and the artificial infection verification. The methylation state detection of the MBL gene promoter region of sheep is carried out through selecting a bisulfite sequencing process, the methylation state and the frequency of each CpG locus in a given region can be accurately detected, three substantially differential CpG methylation loci, CpG3, CpG4 and CpG5, related with the MBL level are found, a case that the MBL level after toxic elimination is lower than the MBL level before the toxic elimination is promoted, and the MBL gene promoter region methylation may be a more substantial characteristic of the MBL level reduction of serum. The method allows the MP infection of sheep and susceptible individuals to be sensitively and accurately detected, and provides complete information and scientific bases for the sheep MBL gene promoter region methylation and the MP infection research of sheep.
Owner:赵宗胜

Detection method for methylation of MGMT gene promoter, and primer group

The invention relates to the fields of molecular biology gene technology and medicine, and specifically discloses a detection method for methylation of an MGMT gene promoter, and a primer group. The methylation degree of a CpG island of the MGMT gene promoter is analyzed, the corresponding primer group is designed, sample genome DNA is subjected to methylation specific PCR (MSP) amplification, andan Ion Torrent semiconductor chip sequencing technology is detected. The detection method has the advantages of large flux, high specificity and sensitivity, stable results, good repeatability and fast detection speed. A fast, reliable and accurate new way is provided for detection, testing, analysis and evaluation of methylation of the MGMT gene promoter, and a theoretical basis is provided forscreening of personalized drugs for sensitive individuals.
Owner:上海联吉医学检验所有限公司

Method for detecting methylation level of synuclein intron 1

The invention relates to a method for detecting the methylation level of a synuclein intron 1 and belongs to the field of bioengineering. The method comprises the following detection steps of: performing sodium hydrogen sulfite treatment; performing polymerase chain reaction (PCR) amplification; preparing a single chain; preparing a pyrophosphoric acid sequencing sample; preparing before pyrophosphoric acid sequencing analysis; analyzing and calculating the methylation state of a corresponding locus by using computer software. The deoxyribonucleic acid (DNA) methylation detection method provided by the invention overcomes the defects in the existing DNA methylation detection technology and has the advantages of quickness, accuracy, high flux and quantitative property. A method for detecting the CpG island methylation level of an alpha-Syn intron 1 based on a pyrophosphoric acid sequencing platform is established. Electrophoresis, Sanger sequencing and pyrophosphoric acid sequencing prove the detection specificity of the method disclosed by the invention. Compared with a sulfite clone sequencing method, the pyrophosphoric acid sequencing method disclosed by the invention is proved to have a high quantitative property. In addition, the method is convenient and quick to operate and high in flux. 96 samples can be sequenced simultaneously, and the time consumption is less than 2 hours, so the method is extremely suitable for clinical examination work.
Owner:CHANGCHUN HENGXIAO BIOTECH CO LTD

Quantitative comparison method for detecting fragile X syndrome based on methylation level and primer used in quantitative comparison method

The invention discloses a method for setting a primer used in a detection method of abnormal methylation of upstream CpG island of fragile X chromosome syndrome FMR1 gene. The designed position of an amplification primer does not cover any CG dinucleotide to ensure that PCR amplification treated by a hydrosulphite has no bias. The method is specifically as follows: a pair of amplification primers designed for the upstream CpG island area of the FMR1 gene: PyroAF: TGAGTGTATTTTTGTAGAAATGGG, PyroAR: TCTCTCTTCAAATAACCTAAAAAC. The invention further provides a method for detecting fragile X syndrome by quantitatively comparing the methylation level of the CpG island stably and quickly. By adopting the method, the defects that the existing method for quantitatively detecting abnormal methylation of a FMR1 promoter is still not mature and especially cannot achieve quantitative detection of a single CpG site are solved.
Owner:绍兴迪安华因生物科技有限公司

Method for detecting gene methylation in glioma

The invention relates to the field of gene detection, and discloses a method for detecting gene methylation in glioma. The method comprises the following steps: (1) treating a DNA standard with a restriction enzyme that specifically recognizes and cleaves unmethylated sites; (2) amplifying the digested product by PCR; (3) combining the PCR product with a cationic conjugated polymer to enable the PCR product to undergo fluorescence energy resonance transfer, and respectively detecting fluorescence intensity of the cationic conjugated polymer and fluorescein; (4) calculating E value of gene methylation level in glioma according to the fluorescence intensity; (5) establishing a methylation degree quantitative standardization curve, determining an optimal detection condition, and detecting a glioma DNA sample to be detected under the optimal detection condition; and (6) judging a methylation degree of the glioma DNA sample, and performing combined analysis to evaluate CpG island methylation phenotype of the glioma. The method can realize purposes of detecting the methylation degree of the glioma gene with high sensitivity and low cost.
Owner:INST OF CHEM CHINESE ACAD OF SCI +1

Methylated coding and non-coding RNA genes as diagnostic and therapeutic tools for human melanoma

Provided herein are methods for the diagnosis and treatment of human melanoma and prediction of early disease genesis to metastasis by assessing CpG island methylation or expression level of epigenetically regulated differentially expressed coding or non-coding genes. Methods of treatment of human melanoma by modifying or regulating the same pathways are also provided.
Owner:SANFORD BURNHAM MEDICAL RES INST

CpG insular methylation test reagent kit and its application

The present invention relates to gene determining technology and is especially CpG insular methlation test reagent kit and its application for diagnosing tumor and screening demethylation medicine. The reagent kit includes primer, medicine for extracting template DNA, medicine for modifying genome, medicine for purifying DNA, specific MSP-PCR reaction system and negative and positive contrast samples. The present invention utilizes human gene sequences and designs primer based on base mismatch principle, and different gene primer is selected to constitute different reagent kit for detecting different diseases. The present invention may be used widely in the diagnosis of cancer and the screening of relevant medicine.
Owner:JINAN UNIVERSITY +2

ABORTIVE PROMOTER CASSETTES AND METHODS FOR FUSION TO TARGETS AND QUANTITATIVE CpG ISLAND METHYLATION DETECTION USING THE SAME

The present invention provides methods to assemble and fuse a full length Abortive Promoter Cassette (APC) to a target nucleic acid during PCR amplification of the target. The linked APC is used to quantify amplicon abundance by the production of RNA Abscripts from the synthetic APC. Stepwise PCR-dependent promoter assembly allows for target-fusion of APCs that are too long to be synthesized as monolithic promoter-primer oligonucleotide reagents.
Owner:RIBOMED BIOTECHNOLOGIES INC

Kit for morbidity-related tumor suppressor gene epigenetic mutation detection of gastrointestinal neoplasms and application thereof

The invention relates to a kit for morbidity-related tumor suppressor gene epigenetic mutation detection of gastrointestinal neoplasms and application thereof. The kit mainly comprises 25 pairs of gastrointestinal neoplasm morbidity-related tumor suppressor gene promotor region CpG-island amplification and sequencing primers of 9 kinds and a polymerase chain reaction (PCR) amplification reagent. Through a PCR amplification product obtained through the kit, a gene CpG-island methylation state can be analyzed through the methods of methylation specific PCR (MSP), combined bisulphite-restrictionanalysis (COBRA) or bisulfite sequencing PCR (BSP) and the like. The kit has the efficient effect of detecting CpG-island methylation and is used for the morbidity-related tumor suppressor gene epigenetic mutation detection of the gastrointestinal neoplasms.
Owner:NANJING UNIV

Method for quantitative PCR detection of maspin gene methylation state and application thereof

The invention relates to a method for quantitative PCR detection of maspin gene methylation state and application thereof. The method comprises: firstly, the specific site and sequence information ofCpG island in the upstream regulatory region of maspin gene coding sequence were determined, and 10 pairs of specific primers were designed to detect the methylation status of CpG island in the upstream regulatory region of maspin gene coding sequence. The methylation of maspin was quantitatively detected by using the different length of CpG island in the upstream regulatory region of maspin coding sequence amplified by the primer. CpG island methylation status in breast canc tissue or upstream regulatory region of maspin coding sequence of breast canc metastasis site of breast cancer patientcan be detected by that method, whether breast canc metastasis and malignant degree of the patient have occurred or not can be diagnosed, and the staging classification and treatment of breast cancercan be assisted in clinic; It can also detect the methylation status of CpG island in the upstream regulatory region of maspin coding sequence of normal breast, judge the incidence of breast cancer, metastasis and malignant degree of breast cancer, and assist early screening of breast cancer, so it has a good application prospect.
Owner:WUHAN UNIV OF SCI & TECH

Primer probe composition for detecting methylation level of DNA (deoxyribonucleic acid) and application of primer probe composition

The invention provides a primer probe composition for detecting the methylation level of DNA (deoxyribonucleic acid) and application of the primer probe composition. Nucleotide sequences of primers comprise at least two of SEQ ID NO:1-2, SEQ ID NO:9-10, SEQ ID NO:15-16 and SEQ ID NO:21-22; and nucleotide sequences of probes comprise at least two of SEQ ID NO:3-8, SEQ ID NO:11-20 and SEQ ID NO:23-28. The primer probe composition is used for detecting CpG island methylation levels of METRNL (meteorin like glial cell differentiation regulator), PDE4D (phosphodiesterase 4D) and MAPT (microtubule associated protein tau) genes, furthermore is used for diagnosing patients suffering from Parkinson's diseases, and is particularly applied to differential diagnosis on patients suffering from early-stage Parkinson's diseases and patients suffering from different subtypes of the Parkinson's diseases. The primer probe composition provided by the invention is low in cost, simple in diagnosis operation and high in practical application value.
Owner:XUANWU HOSPITAL OF CAPITAL UNIV OF MEDICAL SCI

Primer group for detecting cpg island methylation of p16 gene using methylation- specific fluorescence technique

The invention provides a primer group for detecting CpO island methylation of p16 gene using methylation specific fluorescence technique. The primer group comprises a pair of oligonucleotide primers and a fluorescence-labeled probe. Said oligonucleotide primer pair has base sequence represented by SEQ ID NO.1 and SEQ ID NO.2. Said fluorescence-labeled probe has base sequence represented by SEQ ID NO.3 or SEQ NO.4.
Owner:BEIJING CANCER HOSPITAL PEKING UNIV CANCER HOSPITAL

Specific primer pair and kit for detecting methylation of septin9 gene according to high-resolution melting curve

The invention discloses a specific primer pair and kit for detecting methylation of a septin9 gene according to a high-resolution melting (HRM) curve. The invention firstly protects the specific primer pair, and the specific primer pair consists of a single-stranded DNA molecule as shown in SEQ ID NO:1 and a single-stranded DNA molecule as shown in SEQ ID NO:2. The invention further protects application of the specific primer pair to preparation of the kit. The kit has the functions of diagnosing or assisting in diagnosing colorectal carcinoma, detecting methylation of a promoter region of theseptin9 gene, and detecting CpG island methylation of the promoter region of the septin9 gene. By employing the primer pair provided by the invention, by combining methylation specific PCR with HRM curve, methylation of the septin9 gene is analyzed and detected, and the primer pair has the advantages of being simple and convenient to operate, good in specificity, high in sensitivity and low in cost. The specific primer pair and the kit can be used for early screening or auxiliary diagnosis of patients with the colorectal carcinoma, and have good prospects in health screening and clinical auxiliary diagnosis.
Owner:BEIJING KANGMEI TIANHONG BIOTECH

Primers, methods and kits for detection of methylation of cpg islands of sfrp2 gene

The invention discloses primers, method and kit for detecting secreted frizzled-related protein (SFRP)2 gene CpG island methylation. The primers include specific primers for amplifying deoxyribonucleic acid (DNA) segments of three CG loci (related to intestinal cancer) on an SFRP2 gene CpG island from a sample nucleic acid, and primers for pyrosequencing the obtained nucleic acid segments. By the primers, the method and the kit disclosed by the invention, the frequency of the SFRP2 gene methylation related to colorectal cancer susceptibility can be detected by adopting a pyrosequencing technique, so as to screen out susceptible people with early colorectal cancer. The primers, the method and the kit are good in specificity, and high in accuracy, and can detect samples at high flux.
Owner:郑州艾迪康医学检验所(普通合伙)

A kind of primer probe composition and application thereof for detecting dna methylation level

The present invention provides a primer probe composition for detecting DNA methylation level and application thereof, the nucleotide sequence of the primer includes SEQ ID NO:1-2, SEQ ID NO:9-10, SEQ ID NO At least two of: 15‑16 and SEQ ID NO: 21‑22, the nucleotide sequence of the probe includes SEQ ID NO: 3‑8, SEQ ID NO: 11‑20 and SEQ ID NO: 23‑ At least two of 28, the primer probe composition can be used to detect METRNL, PDE4D and MAPT gene CpG island methylation levels, and then diagnose Parkinson's patients, especially for early Parkinson's patients and Parkinson's syndrome Differential diagnosis of different subtypes of patients. The primer-probe composition provided by the invention is low in cost, simple in operation for diagnosis, and has practical application value.
Owner:XUANWU HOSPITAL OF CAPITAL UNIV OF MEDICAL SCI