Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection method for methylation of MGMT gene promoter, and primer group

A detection method, methylation technology, applied in the field of molecular biology gene technology and medical field, to achieve the effect of fast detection speed, stable results and good repeatability

Inactive Publication Date: 2019-06-04
上海联吉医学检验所有限公司
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] At present, there is no report that the Ion Torrent semiconductor chip sequencing technology is specifically used for the detection of the methylation of the CpG island of the MGMT gene promoter and the evaluation of the efficacy of the alkylating drug temozolomide for glioma.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1. Design of primers for methylation detection of MGMT gene promoter CpG island sequence.

[0022] Using bioinformatics knowledge and related bioinformatics software, PCR primers were designed with Primer Premier 5.0 software for the methylation sites of the CpG island sequence of the GMGT gene promoter that can be retrieved from public databases. The primer sequences are:

[0023] Upstream primer: 5'- agggagtggtgagtttcggatatgttgggatagt -3' SEQ ID No: 1

[0024] Downstream primer: 5'- acaacccaaacactcaccaaat -3' SEQ ID No: 2.

[0025] The 5' ends of the upstream primers at the detection sites all contain a barcode sequence 5'-AGGGAGTGGT-3' for identifying sample information.

Embodiment 2

[0026] Example 2, MGMT gene promoter CpG island sequence methylation detection.

[0027] 1) Obtaining the genomic DNA of the sample.

[0028] Genomic DNA was extracted from fresh tumor surgical tissue, punctured tissue or paraffin tissue. DNA was extracted from fresh tumor surgical tissue or punctured tissue by cell lysis, and 400 μL of cell lysis buffer (10 mmol / L Tris-HCl, pH 8.0; 0.1 mol EDTA, pH 8.0; 0.5% SDS) was added to the tissue after freezing and grinding. After mixing, incubate in a 50°C water bath for 30 minutes; after cooling to room temperature, add an equal volume of phenol-chloroform-isoamyl alcohol (volume ratio 25:24:1), mix well, let stand at room temperature for 10 minutes, and then centrifuge at 5000×g for 10 minutes; Transfer the upper aqueous phase to another centrifuge tube, repeat the phenol-chloroform-isoamyl alcohol extraction once; then transfer the upper aqueous phase to another centrifuge tube, add 1 / 10 volume of 3M NaAc (pH5.2), Mix well; add 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the fields of molecular biology gene technology and medicine, and specifically discloses a detection method for methylation of an MGMT gene promoter, and a primer group. The methylation degree of a CpG island of the MGMT gene promoter is analyzed, the corresponding primer group is designed, sample genome DNA is subjected to methylation specific PCR (MSP) amplification, andan Ion Torrent semiconductor chip sequencing technology is detected. The detection method has the advantages of large flux, high specificity and sensitivity, stable results, good repeatability and fast detection speed. A fast, reliable and accurate new way is provided for detection, testing, analysis and evaluation of methylation of the MGMT gene promoter, and a theoretical basis is provided forscreening of personalized drugs for sensitive individuals.

Description

technical field [0001] The present invention relates to the field of molecular biology gene technology and the field of medicine, and relates to the degree of methylation of MGMT gene promoter CpG islands detected by molecular biology methods, in particular to the methylation of MGMT gene promoter CpG islands using Ion Torrent semiconductor chip sequencing technology. Related primers and kits for qualitative and quantitative detection of chemical degree. Background technique [0002] Malignant glioma is one of the refractory tumors in humans. Although the treatment of glioma has been developed from a single surgical treatment to today's comprehensive treatment of surgery plus radiotherapy and chemotherapy, in the past few decades, The prognosis of patients with malignant brain tumors has not been significantly improved, and drug resistance is the main reason for the poor efficacy of chemotherapy. [0003] Some research data have confirmed that DNA repair enzyme O 6 -methy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/6869C12N15/11
Inventor 裘敏燕
Owner 上海联吉医学检验所有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com