Detection method for methylation of MGMT gene promoter, and primer group
A detection method, methylation technology, applied in the field of molecular biology gene technology and medical field, to achieve the effect of fast detection speed, stable results and good repeatability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0021] Example 1. Design of primers for methylation detection of MGMT gene promoter CpG island sequence.
[0022] Using bioinformatics knowledge and related bioinformatics software, PCR primers were designed with Primer Premier 5.0 software for the methylation sites of the CpG island sequence of the GMGT gene promoter that can be retrieved from public databases. The primer sequences are:
[0023] Upstream primer: 5'- agggagtggtgagtttcggatatgttgggatagt -3' SEQ ID No: 1
[0024] Downstream primer: 5'- acaacccaaacactcaccaaat -3' SEQ ID No: 2.
[0025] The 5' ends of the upstream primers at the detection sites all contain a barcode sequence 5'-AGGGAGTGGT-3' for identifying sample information.
Embodiment 2
[0026] Example 2, MGMT gene promoter CpG island sequence methylation detection.
[0027] 1) Obtaining the genomic DNA of the sample.
[0028] Genomic DNA was extracted from fresh tumor surgical tissue, punctured tissue or paraffin tissue. DNA was extracted from fresh tumor surgical tissue or punctured tissue by cell lysis, and 400 μL of cell lysis buffer (10 mmol / L Tris-HCl, pH 8.0; 0.1 mol EDTA, pH 8.0; 0.5% SDS) was added to the tissue after freezing and grinding. After mixing, incubate in a 50°C water bath for 30 minutes; after cooling to room temperature, add an equal volume of phenol-chloroform-isoamyl alcohol (volume ratio 25:24:1), mix well, let stand at room temperature for 10 minutes, and then centrifuge at 5000×g for 10 minutes; Transfer the upper aqueous phase to another centrifuge tube, repeat the phenol-chloroform-isoamyl alcohol extraction once; then transfer the upper aqueous phase to another centrifuge tube, add 1 / 10 volume of 3M NaAc (pH5.2), Mix well; add 2...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com