Materials and methods for assaying for methylation of CpG islands associated with genes in the evaluation of cancer

a technology of methylation and assays, applied in the field of materials and methods for assaying for methylation of cpg islands associated with genes in the evaluation of cancer, can solve the problems of downregulation or silencing of the associated gene, the theoretical limit of the sensitivity of such a test is only approximately 90%, and the marker may not be suitable individually for prostate cancer diagnosis

Inactive Publication Date: 2008-09-04
EUCLID DIAGNOSTICS
View PDF6 Cites 33 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0020]Also provided are kits that include one

Problems solved by technology

Methylation of CpG islands within promoter regions can result in the downregulation or silencing of the associated gene.
However, if diagnosis of prostate cancer relied solely on the detection of the methylation of the CpG island in the GSTP1 gene, the theoretical limit of the sensitivity of such a test would only be approximately 90%.
Such markers may not be suitable individually for prostate cancer diagnosis.
While the PSA test has resulted in the majority of prostate cancer cases being diagnosed in asymptomatic men (Mettlin et al., Cancer, 83(8): 1679-1684 (1998a); Mettlin et al., Cancer, 82(2): 249-251 (1998b); Humphrey et al., J. Urol., 155: 816-820 (1996); and Grossfeld et al., Epidemiol. Rev., 23(1): 173-180 (2001)), the PSA test suffers from poor specificity, which can be as low as 33% when a PSA cut-off level of 2.6 ng / ml is used (Thompson et al., N. Engl. J. Med., 350: 2239-2246 (2004)), even though the sensitivity can be as high as 83%.
The poor specificity of the PSA test is a direct result of increased secretion of PSA in other diseases of the prostate, such as BPH and prostatitis.
Over 1 million needle biopsies of prostates are performed each year at a cost of about $1,500 each and much discomfort to the patient.
However, less than 200,000 of these result in a diagnosis of prostate cancer.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Materials and methods for assaying for methylation of CpG islands associated with genes in the evaluation of cancer
  • Materials and methods for assaying for methylation of CpG islands associated with genes in the evaluation of cancer
  • Materials and methods for assaying for methylation of CpG islands associated with genes in the evaluation of cancer

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0058]This example demonstrates the determination of the methylation status of markers based on methylation-specific PCR amplification. Paraffin-embedded prostate tissues were obtained following radical prostatectomies. The tissue samples were sectioned into 23 10-micron sections and slide 1, 12, and 23 were stained using hematoxylin and eosin (H&E). Using the H&E slides as guide, the areas corresponding to the tumor tissues were microdissected from the unstained slides. The remaining tissues were recovered to use as a normal paired sample. Following deparaffinization using two xylene extractions and two ethanol washes, the DNA was isolated from the tumor tissue and surrounding normal tissues using standard proteinase K digest for 5 days at 50° C., extraction with phenol / chloroform and ethanol precipitation (Current Protocols in Molecular Biology, edited by Ausubel, et al., Wiley-Interscience (New York 1988, revised 1988-2006)). The DNA was resuspended in TE8 and the quality and qua...

example 2

[0062]This example demonstrates the determination of the methylation status of CpG islands at the ADRB3 locus by DNA sequencing. DNA is obtained from tumor samples and treated with sodium bisulfite as described in example 1. Two microliters of the bisulfite treated DNA are amplified with the following primers: ADRB3-F1: GAGAAGAGGAAGGTAGAAGGAG [SEQ ID NO: 221] and ADRB3-R1: CTACCTAACTATAACCAACCC [SEQ ID NO: 222] for 40 cycles as described in example 1 except for the annealing temperature, which is lowered to 55° C. The amplified 250 bp product is purified using QIAquick PCR purification kit (Qiagen, Valencia Calif.) and recovered in TE8. Fifty nanograms of the ADRB3 amplified product is sequenced using 1.25 pmole of ADRB3-F2:ACGGAGGAGGATAGTAGTACG [SEQ ID NO: 223] using BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems) and the sequencing reaction is purified using Centri-Sep columns (Applied Biosystems) according to the manufacturer's protocols. The products of the sequ...

example 3

[0064]This example demonstrates the determination of the methylation pattern of multiple CpG islands associated with KIFC2, GFRA1 and GPX7 using terminator-coupled linear amplification. From DNA from tumor samples prepared as described in example 1, fragments of the CpG islands associated with KIFC2, GFRA1, GPX7 are amplified individually using the mF1 and mR1 primers shown below for each CpG island. The amplification reactions are performed for 42 cycles as described in example 1 except for the annealing temperature, which was lowered to 58° C. An aliquot of the amplification reaction is separated on an 8% acrylamide gel to verify that fragments of the appropriate length are obtained (264 bp for KIFC2, 326 bp for GFRA1, 367 bp for GPX7). The product of the PCR reaction were purified using QIAQUICK PCR purification kit (Qiagen).

[0065]Each amplification product (25 nanograms) is subjected to linear terminator-coupled amplification using 1.5 pmoles of the fluorescently labeled F2 prim...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Electric chargeaaaaaaaaaa
Electric dipole momentaaaaaaaaaa
Login to View More

Abstract

Provided are methods, reagents, and kits for evaluating cancer, such as prostate cancer, in a subject. Disclosed methods of evaluating cancer include methods of diagnosing cancer, methods of prognosticating cancer and methods of assessing the efficacy of cancer treatment. The methods include assaying a biological sample for methylation of a CpG island associated with specified genes. Provided reagents and kits include primers suitable for amplifying at least a portion of a target CpG islands associated with specified genes.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This patent application is a continuation of International Patent Application No. PCT / US2006 / 060685, filed Nov. 8, 2006, designating the United States, which claims the benefit of U.S. Provisional Patent Application No. 60 / 734,577, filed Nov. 8, 2005, which are incorporated by reference herein in their entirety.INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY[0002]Incorporated by reference in its entirety herein is a computer-readable nucleotide / amino acid sequence listing submitted concurrently herewith and identified as follows: One 214,875 Byte ASCII (Text) file named “702375_ST25.TXT,” created on May 2, 2008.BACKGROUND OF THE INVENTION[0003]Phosphate linked cytosine-guanine (CpG) dinucleotides are statistically underrepresented in the genomes of higher eukaryotes, including mammals. The dinucleotide is reportedly found at only 5-10% of its predicted frequency. The majority of CpG dinucleotides that do remain in the huma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68G01N33/53C07H21/00
CPCC12Q1/6886Y10T436/143333C12Q2600/154
InventorFREIJE, WADIHANUSSKERN, DEBORAH
OwnerEUCLID DIAGNOSTICS