A kind of hairpin dna probe and its quantitative detection method for thrombin

A DNA probe and quantitative detection technology, which is applied in the field of analytical chemistry and molecular biology spectral analysis, can solve problems affecting the spectral properties of the system, and achieve effective quantitative detection, significant specificity, and simple and specific effects

Active Publication Date: 2016-06-01
SHANTOU UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the same time, the different accumulation degrees of MB and DNA molecules will also affect the spectral properties of the system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of hairpin dna probe and its quantitative detection method for thrombin
  • A kind of hairpin dna probe and its quantitative detection method for thrombin
  • A kind of hairpin dna probe and its quantitative detection method for thrombin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Correlation detection was performed using a spectrofluorometer. The base sequence of the hairpin DNA structure embedded with the thrombin aptamer is as follows: 5'-GAATTCTTAAAGGTTGGTGTGGTTGGAATTC-3'. Among them, 5'-GAATTCTTAAAGGTTGGTGTGGTTGGAATTC-3', GGTTGGTGTGGTTGG is the aptamer sequence of thrombin, the part formed by the pairing of 5'-GAATTC and 3'-CTTAAG is the stem part of the hairpin DNA stem-loop structure, and AATTCTTAAAGGTTGGTGTGGTTGG is the stem part with CTBA Complementary base sequence.

Embodiment 2

[0033] The method for the quantitative detection of thrombin by hairpin DNA probes includes the following steps: in a 1.5mL centrifuge tube, add 898 μL of thrombin solutions of different concentrations and H-eTBA ( 1 μL, 10 μM, react at 95°C for 10 minutes before the experiment, and then naturally cool to room temperature) solution. After incubating the reaction at 37°C for 25 min, CTBA solution (1 μL, 10 μM) was added, and the mixed solution was incubated at 37°C for 1 h. Finally, add MB solution (100 μL, 5×10 -5 M), and mix the reaction thoroughly and uniformly at room temperature. The total volume of the system is 1000 μL. Finally, the solution was placed on a fluorescence spectrophotometer, and resonance light scattering scanning was performed in the range of 225 to 700 nm with the same excitation and emission wavelengths to obtain a resonance light scattering spectrum for quantitative detection of thrombin. The excitation light slit width of the resonance light scatter...

Embodiment 3

[0036] A series of comparative experiments a-h were used to characterize the resonance light scattering spectra of the system, and a comparative relationship diagram of the resonance light scattering intensity of the MB-DNA reaction system under different conditions was obtained. Where a is MB+H-eTBA+CTBA; b is MB+H-eTBA+CTBA+thrombin; c is MB+H-eTBA; d is MB+CTBA; e is MB+thrombin; f is thrombin; g is MB ; h is H-eTBA+CTBA. (where pH=7.40; MB: 5×10 -5 M; H-eTBA: 1 μL, 10 μM; CTBA: 1 μL, 10 μM; thrombin: 450.5 μg / L).

[0037] Depend on figure 2 It can be seen that the shape of the RLS curve is almost consistent from curve a to h, so the RLS peak at 370nm can be used as the characteristic absorption peak of the system for the quantitative detection of thrombin. Such as figure 2 As shown, the RLS signal intensity of MB+H-eTBA+CTBA (curve a) is stronger, while that of MB+H-eTBA, MB+CTBA, MB+thrombin, thrombin, MB and H-eTBA+CTBA (inset: curve c The RLS signal to h) is negl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a hairpin DNA probe and a method for quantitatively detecting thrombin. A thrombin aptamer is embedded into the hairpin DNA probe, the sequence of the thrombin aptamer refers to the base sequences of 5'-GAATTC TTAAA GGTTGGTGTGGTTG GAATTC-3' and GGTTGGTGTGGTTG G, and a part formed by pairing 5'-GAATTC and 3'-CTTAAG is a stem part of a hairpin DNA stem-loop structure. The method comprises the following steps: in a Tris-HCl buffer solution system, reacting a hairpin DNA solution and thrombin at the constant temperature of 37 DEG C, adding a CTBA solution to react with the previous solution, adding an MB solution, completely mixing and reacting at room temperature, and finally testing the analysis and detection performance of the probe on the thrombin on a fluorospectro photometer. The hairpin DNA probe disclosed by the invention is simple, convenient and high in specificity, can be used for effectively performing quantitative detection on the thrombin and has wide linear range.

Description

technical field [0001] The invention relates to the fields of analytical chemistry and molecular biology spectrum analysis, in particular to the design of a hairpin DNA molecular probe and the application of the resonance light scattering technology of the probe in the detection of thrombin. Background technique [0002] Thrombin is an important multifunctional active protein that plays a key role in many physiological and pathological processes, such as blood coagulation, thrombosis, inflammation, angiogenesis, tumor growth and metastasis. Thrombin can also be used as a therapeutic agent and biomarker for some diseases related to abnormal blood coagulation, such as lung metastatic tumors. Nowadays, in clinical analysis, protein detection methods mainly rely on the use of antibodies. Although common detection methods can also achieve quantitative detection of thrombin, there are still some inconveniences such as the need for enzyme labeling, the use of radioactive substance...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N33/68G01N21/64C12N15/115
CPCG01N21/49G01N21/64G01N33/68
Inventor高文华黄晓鹏陈耀文陈汉佳张歆
OwnerSHANTOU UNIV