CRISPR-Cas based isothermal nucleic acid detection method and kit

A detection method and nucleic acid technology, applied in the field of isothermal nucleic acid detection and kits based on CRISPR-Cas, can solve the problems that RNA detection cannot realize one-step single-tube detection, the RPA method has complex components, and increases the difficulty of operation, etc., to achieve low false positives Positive, easy-to-step, high-sensitivity effects

Active Publication Date: 2018-12-21
HANGZHOU MATRIDX BIOTECH CO LTD
View PDF6 Cites 22 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the SHERLOCK method cannot achieve one-step single-tube detection for RNA detection, and the RPA method has complex components and poor stability, which increases the difficulty of operation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR-Cas based isothermal nucleic acid detection method and kit
  • CRISPR-Cas based isothermal nucleic acid detection method and kit
  • CRISPR-Cas based isothermal nucleic acid detection method and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1: Detection of RNA targets using the present invention

[0060] RNA (Target1) is selected as the target sequence, and the Target1 sequence is: aucgauagucuagucaucguacguagcuagucagucaauaucgauca;

[0061] The preparation method of the target RNA is to synthesize the forward primer (T7-F) taatacgactcactatag of the forward primer (T7-F) taatacgactcactatag of the reverse complementary long primer (Target1-primer-R) tgatcgatattgactgactagctacgtacgatgactagactatcgatccctatagtgagtcgtattaT7 comprising the T7 sequence, and make the DNA incomplete double strand by annealing of the double primers. T7 transcriptase was reacted overnight at 37 degrees, and then purified using the ZYMO RNA CLEAN&CONCENTRATION kit (Zymo Research Company) to obtain target RNA, which was stored at -20 degrees or -80 degrees after preparation.

[0062] Preparation of guide DNA: Synthesize the reverse complementary long primer crDNA-target1-R:agctacgtacgatgactagacGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCC...

Embodiment 2

[0067] Embodiment 2: Using the present invention to detect single-stranded DNA targets

[0068] DNA (Target2) is selected as the target sequence, and the Target2 sequence is: atcgatagtctagtcatcgtacgtagctagtcagtcaatatcgatca.

[0069] The method for preparing the target single-stranded DNA is to synthesize a primer (Target2-primer-F): atcgatagtctagtcatcgtacgtagctagtcagtcaatatcgatcacccaatgtgacatcgctga, dissolve in water and dilute to 100uM.

[0070] Preparation of guide DNA: Synthesize the reverse complementary long primer crDNA-target2-R containing the T7 sequence: agctacgtacgatgactagacGTTTTAGTCCCCTTCGTTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAA T7 forward primer (T7-F) taatacgactcactatag, and make the DNA incompletely double-stranded by annealing the double primers. Store at -20°C or -80°C after preparation.

[0071] Amplification and detection reaction: Add the single-stranded DNA to be detected into the reaction system, the reaction system includes, buffer (trishydrochloride, 50...

Embodiment 3

[0074] Example 3: Detection of double-stranded DNA targets using the present invention

[0075] Select DNA (Target3) as the target sequence, and the Target3 sequence is:

[0076] atcgatagtctagtcatcgtacgtagctagtcagtcaatatcgatcagacatcgaggagatcaaaacccagaaggtccgcatcgaaggc.

[0077] The preparation method of the target DNA is to synthesize a reverse complementary long primer (Target3-primer-R)

[0078] gccttcgatgcggaccttctgggttttgatctcctcgatgtctgatcgatattgactgactagctacgtacgatgactagactatcgat, and forward primer (Target3-primer-F)

[0079] atcgatagtctagtcatcgtacgtagctagtcagtcaatatcgatcagacatcgaggagatcaaaacccagaaggtccgcatcgaaggc, the primers were mixed and annealed, and stored at -20 degrees or -80 degrees after preparation.

[0080] Preparation of guide DNA: Synthesize the reverse complementary long primer crDNA-target3-R containing the T7 sequence: agctacgtacgatgactagacGTTTTAGTCCCCTTCGTTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAA T7 forward primer (T7-F) taatacgactcactatag, and make ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CRISPR-Cas based technology for normal-temperature / isothermal rapid detection of ribonucleic acid and a detection method. The invention aims to perform in-vitro ribonucleic acid amplification on multiple disclosed gentically engineered enzymes and chemical components and to realize amplification and detection of specific ribonucleic acid (RNA) or desoxyribonucleic acid (DNA) quickly in one step or two steps in normal-temperature / isothermal condition so that the detection of each nucleic acid is faster and more convenient. The method comprises the following steps: (1)performing nucleic acid extraction to obtain the RNA, single-stranded DNA or double-stranded DNA of a to-be-detected sample; (2) conducting a reaction with to-be-detected nucleic acid by using the combined enzyme of reverse transcriptase, transcriptase, ribonuclease H and CRISPR-associated protein 13 as well as a nucleic acid fluorescent probe in an isothermal condition, wherein if the to-be-detected nucleic acid is DNA, a pre-denaturation step is added before the reaction; (3) detecting the fluorescence signal to judge whether target nucleic acid exists in the to-be-detected sample.

Description

technical field [0001] The invention is a new nucleic acid isothermal amplification detection technology, using reverse transcriptase, RNA polymerase and Cas13a protein under normal temperature and isothermal conditions, can quickly, one-step, and single-tube complete the amplification and detection of specific DNA or RNA reaction. Background technique [0002] Polymerase chain reaction (PCR) amplification and detection of deoxyribonucleic acid (DNA) has become the most classic and general method in the field of molecular detection. Likewise, in vitro amplification of RNA is mostly performed using reverse transcription PCR, a technique derived from PCR. Reverse transcription PCR is generally divided into two steps. The first step is to use reverse transcriptase to reverse transcribe RNA into cDNA, and then use cDNA as a template for PCR amplification to achieve RNA amplification and detection. However, PCR itself needs to rely on a high-precision temperature cycler for det...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6844
CPCC12Q1/6844C12Q2547/101C12Q2521/119C12Q2521/327C12Q2521/107C12Q2527/127C12Q2563/107
Inventor韩序高晓庆马秀玲施慧玲段昆欧阳川
OwnerHANGZHOU MATRIDX BIOTECH CO LTD