Supercharge Your Innovation With Domain-Expert AI Agents!

A kind of cultivation method of very early maturing rice

A breeding method and rice technology, which is applied in the field of crop genetics and breeding, can solve the problems of restricting popularization and application, inconsistencies in the maturity period of the whole plant of the main panicle and early maturing materials, and restricting cultivation.

Active Publication Date: 2021-07-06
BIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The inconsistent ripening period of the whole plant of this kind of extremely early-maturing main panicle not only limits the cultivation of extremely early-maturing (similar to the growth period of the main panicle) rice varieties, but also restricts their popularization and application in production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of cultivation method of very early maturing rice
  • A kind of cultivation method of very early maturing rice
  • A kind of cultivation method of very early maturing rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1: Utilize hybridization method to create oligo-tiller early-maturing rice material

[0030] Using a short-growing rice mutant sgp(t) (characterized by early maturation of the main panicle) (Liu Huaqing et al. (2008), Science Bulletin, 53(13):1552-1559, image 3 ) was hybridized with the oligo-tiller rice variety Nanchanghui, the hybrid F1 was self-crossed after planting, F2 seeds were obtained, and a F2 population of 1500 plants was planted; the heading stage of the main panicle, tillering, and maturity of the whole plant were investigated according to a single plant, and other agronomic traits were investigated in combination. Select plants with compact and upright leaves, plant height less than 1m, seed setting rate of more than 85%, main panicle sowing start within 50 days, oligotillers (total number of panicles ≤ 3), and whole plant maturity within 90 days to harvest as a single plant , planted into F3 strains; then select and plant F4, F5, F6 according ...

Embodiment 2

[0031] Example 2: Using genome editing technology to create oligo-tiller early-maturing rice materials

[0032] 1. Genome editing target site selection and vector construction

[0033] Selection of rice ideal plant type gene IPA1, using PCR to amplify short growth period mutant sgp(t) background IPA1 Gene sequence, after sequencing, it was found that its IPA1 The gene sequence is consistent with that of Nipponbare. According to the principle of CRISPR / CAS9 target site design, two target sites were selected in the miRNA156 binding site area, and their sequences were:

[0034] CIPA1-1, TCTCTTCTGTCAACCCAGCCATGG;

[0035] CIPA1-2, TCTCTCTCTTCTGTCAACCCAGC.

[0036] The backbone of the plant Cas9 / gRNA plasmid (VK005-01 Cas9 / gRNAVector) provided by Beijing Weishang Lide Company was used, which already included the 35S promoter and its hygromycin resistance gene, the Ubi promoter and its The rice Cas9 protein that has been optimized and the rU6 promoter that starts the gRNA als...

Embodiment 3

[0049] Embodiment 3: oligo-tiller early-maturing rice variety cultivation

[0050] Utilize the early-maturing oligo-tiller rice intermediate material created in Example 1 fte Hybrid rice varieties Minghui 86 and 93-11 were crossed, the hybrid F1 was backcrossed with the corresponding Minghui 86 and 93-11 respectively, and the backcross generation 1 (BC1) plants with early heading and oligotillers were selected to continue backcrossing with the recurrent parents. The 5th generation of backcross (BC5) plants were self-crossed to obtain homozygous oligotiller early-maturing rice varieties Zaomaming Minghui 86 (E86) and Zaoma 93-11 (E9311) with the background of recurrent parents. Their growth periods were 76 days and 78 days.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for cultivating extremely early-maturing rice, which belongs to the field of crop genetics and breeding. The present invention relates to the utilization of rice materials with early maturing main panicles. Aiming at the characteristics of the large difference between the maturity period of main panicles and the maturity period of tiller panicles of the rice materials with early maturing main panicles, a strategy of reducing the number of rice tillers and shortening the maturity period of the whole plant is proposed, that is, by Regulate the number of rice tillers to achieve the purpose of regulating rice maturity; create oligo-tiller early-maturing rice materials through hybrid breeding technology or genome editing technology; then use the oligo-tiller early-maturing rice materials to hybridize with excellent rice varieties, and then continuously backcross to select An oligo-tiller early-maturing rice individual obtains an excellent oligo-tiller early-maturing rice variety with a growth period of less than 90 days. This early-maturing rice variety is especially suitable for direct seeding cultivation and applied to rice production.

Description

technical field [0001] The invention relates to the field of crop genetics and breeding, in particular to a method for cultivating extremely early-maturing rice. Background technique [0002] Rice growth period is one of the important agronomic traits of rice varieties, which directly affects the suitable planting area, planting season and farming method of rice. The growth period of rice varieties can be divided into three stages: the vegetative growth period, the vegetative growth and reproductive growth period, and the fruiting and maturity period. Generally, the time required for the vegetative growth, reproductive growth, and fruiting and maturity stages of rice is relatively stable. Therefore, the length of the growth period of different varieties is mainly determined by the length of the vegetative growth period. [0003] Early-maturing rice varieties have a shorter growth period, more flexible seasonal arrangements in production, and wider regional adaptability. The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A01G22/22A01H1/02
CPCA01H1/02A01G22/22
Inventor 刘华清王锋杨绍华吴明基林艳陈在杰苏军周淑芬颜静宛陈睿陈建民罗家密
Owner BIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More