Supercharge Your Innovation With Domain-Expert AI Agents!

Method for cultivating very early-maturing rice

A cultivation method and rice technology, applied in the field of crop genetics and breeding, can solve the problems of restricting cultivation, inconsistency in the whole plant maturity of extremely early maturing materials for main panicles, restricting popularization and application, etc., and achieving the effect of reducing the number of tillers

Active Publication Date: 2019-01-08
BIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The inconsistent ripening period of the whole plant of this kind of extremely early-maturing main panicle not only limits the cultivation of extremely early-maturing (similar to the growth period of the main panicle) rice varieties, but also restricts their popularization and application in production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for cultivating very early-maturing rice
  • Method for cultivating very early-maturing rice
  • Method for cultivating very early-maturing rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1: Utilize hybridization method to create oligo-tiller early-maturing rice material

[0030] Using a short-growing rice mutant sgp(t) (characterized by early maturation of the main panicle) (Liu Huaqing et al. (2008), Science Bulletin, 53(13):1552-1559, image 3 ) was hybridized with the oligo-tiller rice variety Nanchanghui, the hybrid F1 was self-crossed after planting, and F2 seeds were obtained, and a F2 population of 1500 plants was planted; the heading stage of the main panicle, tillering, and maturity of the whole plant were investigated on a single plant basis, and other agronomic traits were investigated in combination. Select plants with compact and upright leaves, plant height less than 1m, seed setting rate above 85%, main panicle sowing start within 50 days, oligotillers (total number of panicles ≤ 3), and whole plant maturity within 90 days to harvest as a single plant , planted into F3 strains; then select and plant F4, F5, F6 according to the ...

Embodiment 2

[0031] Example 2: Using genome editing technology to create oligo-tiller early-maturing rice materials

[0032] 1. Genome editing target site selection and vector construction

[0033] Selection of rice ideal plant type gene IPA1, using PCR to amplify short growth period mutant sgp(t) background IPA1 Gene sequence, after sequencing, it was found that its IPA1 The gene sequence is consistent with that of Nipponbare. According to the principle of CRISPR / CAS9 target site design, two target sites were selected in the miRNA156 binding site area, and their sequences were:

[0034] CIPA1-1, TCTCTTCTGTCAACCCAGCCATGG;

[0035] CIPA1-2, TCTCTCTCTTCTGTCAACCCAGC.

[0036] The backbone of the plant Cas9 / gRNA plasmid (VK005-01 Cas9 / gRNAVector) provided by Beijing Weishang Lide Company was used, which already included the 35S promoter and its hygromycin resistance gene, the Ubi promoter and its The optimized Cas9 protein adapted to rice and the rU6 promoter that starts the gRNA also i...

Embodiment 3

[0049] Embodiment 3: oligo-tiller early-maturing rice variety cultivation

[0050] Utilize the early-maturing oligo-tiller rice intermediate material created in Example 1 fte Hybrid rice varieties Minghui 86 and 93-11 were crossed, the hybrid F1 was backcrossed with the corresponding Minghui 86 and 93-11 respectively, and the backcross generation 1 (BC1) plants with early heading and oligotillers were selected to continue backcrossing with the recurrent parents. The 5th generation of backcross (BC5) plants were self-crossed to obtain homozygous oligotiller early-maturing rice varieties Zaomaming Minghui 86 (E86) and Zaoma 93-11 (E9311) with the background of recurrent parents. Their growth periods were 76 days and 78 days.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for cultivating very early-maturing rice and belongs to the field of crop genetics and breeding. The invention relates to the utilization of a main spike early-maturingrice material, for a characteristic that a main spike maturation period and a tiller spike maturation period of the main spike early-maturing rice material have a large difference, and a strategy forreducing the tiller number of the rice and shortening the maturation period of the whole plant is proposed, which means that the purpose of controlling the rice maturation period is achieved by controlling the tiller number of rice. A less tiller early-maturing rice material is created through a cross breeding technique or genome editing technique, then the less tiller early-maturing rice material and excellent rice varieties are hybridized, followed by continuous backcrossing, a less tiller early-maturing rice individual is selected, a less tiller early-maturing excellent rice variety with agrowth period within 90 days is obtained, and the early-maturing rice variety is particularly suitable for direct seeding cultivation in rice production.

Description

technical field [0001] The invention relates to the field of crop genetics and breeding, in particular to a method for cultivating extremely early-maturing rice. Background technique [0002] Rice growth period is one of the important agronomic traits of rice varieties, which directly affects the suitable planting area, planting season and farming method of rice. The growth period of rice varieties can be divided into three stages: the vegetative growth period, the vegetative growth and reproductive growth period, and the fruiting and maturity period. Generally, the time required for the vegetative growth, reproductive growth, and fruiting and maturity stages of rice is relatively stable. Therefore, the length of the growth period of different varieties is mainly determined by the length of the vegetative growth period. [0003] Early-maturing rice varieties have a shorter growth period, more flexible seasonal arrangements in production, and wider regional adaptability. The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01G22/22A01H1/02
CPCA01H1/02A01G22/22
Inventor 刘华清王锋杨绍华吴明基林艳陈在杰苏军周淑芬颜静宛陈睿陈建民罗家密
Owner BIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More