High-Purity Steviol Glycosides

a technology of steviol glycosides and steviol, which is applied in the direction of transferases, tobacco, tobacco treatment, etc., can solve the problems of unsuitable commercial use methods

Inactive Publication Date: 2016-07-14
PURECIRCLE SDN BHD
View PDF7 Cites 27 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present invention provides a biocatalytic process for preparing a composition comprising a target steviol glycoside by contacting an organic compound with a biocatalyst, such as an enzyme or a microorganism, that converts the organic compound to the target steviol glycoside. This process offers a more efficient and cost-effective way to produce desired steviol glycosides, as compared to traditional methods. The target steviol glycoside can be any steviol glycoside, such as stevioside, rebaudioside A, or rebaudioside M. The biocatalyst used in the process can be an enzyme or a cell comprising one or more enzymes capable of converting the organic compound to the target steviol glycoside. The process can be carried out using a whole cell suspension, a crude lysate, or purified enzymes. The invention also provides a method for preparing a target steviol glycoside by contacting an organic compound with a microorganism that produces the necessary enzymes and UDP-glucosyltransferases for the conversion process.

Problems solved by technology

Although methods are known for preparing steviol glycosides from Stevia rebaudiana, many of these methods are unsuitable for use commercially.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-Purity Steviol Glycosides
  • High-Purity Steviol Glycosides
  • High-Purity Steviol Glycosides

Examples

Experimental program
Comparison scheme
Effect test

example 1

In-Vivo Production of UGT76G1

[0285]NcoI and NdeI restriction sides were added to the original nucleic sequence as described in Genbank accession no. AAR06912.1. After codon optimization the following nucleic sequence was obtained:

(SEQ ID NO: 1)CCATGGCCCATATGGAAAACAAAACCGAAACCACCGTTCGTCGTCGTCGCCGTATTATTCTGTTTCCGGTTCCGTTTCAGGGTCATATTAATCCGATTCTGCAGCTGGCAAATGTGCTGTATAGCAAAGGTTTTAGCATTACCATTTTTCATACCAATTTTAACAAACCGAAAACCAGCAATTATCCGCATTTTACCTTTCGCTTTATTCTGGATAATGATCCGCAGGATGAACGCATTAGCAATCTGCCGACACATGGTCCGCTGGCAGGTATGCGTATTCCGATTATTAACGAACATGGTGCAGATGAACTGCGTCGTGAACTGGAACTGCTGATGCTGGCAAGCGAAGAAGATGAAGAAGTTAGCTGTCTGATTACCGATGCACTGTGGTATTTTGCACAGAGCGTTGCAGATAGCCTGAATCTGCGTCGTCTGGTTCTGATGACCAGCAGCCTGTTTAACTTTCATGCACATGTTAGCCTGCCGCAGTTTGATGAACTGGGTTATCTGGATCCGGATGATAAAACCCGTCTGGAAGAACAGGCAAGCGGTTTTCCGATGCTGAAAGTGAAAGATATCAAAAGCGCCTATAGCAATTGGCAGATTCTGAAAGAAATTCTGGGCAAAATGATTAAACAGACCAAAGCAAGCAGCGGTGTTATTTGGAATAGCTTTAAAGAACTGGAAGAAAGCGAACTGGAAACCGTGATTCGTGAAATTCCGGCACCGAGCTTTCTGATTCCGCTGCCGA...

example 2

In-Vitro Production of UGT76G1

[0290]The S30 T7 High Yield Protein expression system kit from Promega was used. 4 μg of UGT76G1_pET30a+ plasmid from E. coli EC100 was mixed with 80 μL of S30 premix plus and 72 μL of S30 T7 extract was added. Nuclease-free water was added in order to obtain a total volume of 200 μL and the resulting solution was incubated for 2 h at 30° C. 180 μL was used in the catalytic test reaction.

example 3

In-Vitro Production of UGT91D2

[0291]NcoI and NdeI restriction sides were added to the original nucleic sequence as described in Genbank accession no. ACE87855.1. After codon optimization the following nucleic sequence was obtained:

(SEQ ID NO: 2)CCATGGCACATATGGCAACCAGCGATAGCATTGTTGATGATCGTAAACAGCTGCATGTTGCAACCTTTCCGTGGCTGGCATTTGGTCATATTCTGCCGTATCTGCAGCTGAGCAAACTGATTGCAGAAAAAGGTCATAAAGTGAGCTTTCTGAGCACCACCCGTAATATTCAGCGTCTGAGCAGCCATATTAGTCCGCTGATTAATGTTGTTCAGCTGACCCTGCCTCGTGTTCAAGAACTGCCGGAAGATGCCGAAGCAACCACCGATGTTCATCCGGAAGATATTCCGTATCTGAAAAAAGCAAGTGATGGTCTGCAGCCGGAAGTTACCCGTTTTCTGGAACAGCATAGTCCGGATTGGATCATCTATGATTATACCCATTATTGGCTGCCGAGCATTGCAGCAAGCCTGGGTATTAGCCGTGCACATTTTAGCGTTACCACCCCGTGGGCAATTGCATATATGGGTCCGAGCGCAGATGCAATGATTAATGGTAGTGATGGTCGTACCACCGTTGAAGATCTGACCACCCCTCCGAAATGGTTTCCGTTTCCGACCAAAGTTTGTTGGCGTAAACATGATCTGGCACGTCTGGTTCCGTATAAAGCACCGGGTATTAGTGATGGTTATCGTATGGGTCTGGTTCTGAAAGGTAGCGATTGTCTGCTGAGCAAATGCTATCATGAATTTGGCACCCAGTGGCTGCCGCTGCTGGAAACCCTGCATCAGGTTCCGGTTGTTCCGGTGGGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wet weightaaaaaaaaaa
total volumeaaaaaaaaaa
total volumeaaaaaaaaaa
Login to View More

Abstract

Methods of preparing highly purified steviol glycosides, particularly rebaudiosides A, D and M are described. The methods include utilizing recombinant microorganisms for converting various staring compositions to target steviol glycosides. In addition, novel steviol glycosides reb D2 and reb M2 are disclosed, as are methods of preparing the same. The highly purified rebaudiosides are useful as non-caloric sweetener in edible and chewable compositions such as any beverages, confectioneries, bakery products, cookies, and chewing gums.

Description

CROSS REFERENCE TO RELATED APPLICATIONS[0001]This application claims priority to U.S. Provisional Patent Application No. 61 / 827,922, filed May 28, 2013; U.S. Provisional Patent Application No. 61 / 843,544, filed Jul. 8, 2013; U.S. Provisional Patent Application No. 61 / 861,528, filed Aug. 2, 2013; U.S. Provisional Patent Application No. 61 / 881,166, filed Sep. 23, 2013; U.S. Provisional Patent Application No. 61 / 885,084, filed Oct. 1, 2013; U.S. Provisional Patent Application No. 61 / 904,751, filed Nov. 15, 2013; U.S. Provisional Patent Application No. 61 / 913,482, filed Dec. 9, 2013; U.S. Provisional Patent Application No. 61 / 921,635, filed Dec. 30, 2013; U.S. Provisional Patent Application No. 61 / 925,329, filed Jan. 9, 2014 and U.S. Provisional Patent Application No. 61 / 939,855, filed Feb. 14, 2014. The above-referenced priority documents are incorporated fully herein in their entirety.TECHNICAL FIELD[0002]The present invention relates to a biocatalytic process for preparing compositio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): A23L1/236A23L2/60C07H15/256C12P19/56A23L27/30
CPCA23L1/2363C07H15/256A23V2002/00A23L2/60C12P19/56C07H1/06C12N9/10A24B15/302A23L27/33Y02P20/582A23V2250/258A24B15/10
InventorPRAKASH, INDRABUNDERS, CYNTHIASONI, PANKAJMARKOSYAN, AVETIKCYRILLE, JARRINBADIE, AURELIENHALLE, ROBER TER
OwnerPURECIRCLE SDN BHD