Sex appraisal process for pigeon for meat

An identification method, the technology of meat pigeons, applied in the field of molecular biology, can solve the problems of animal injury, etc., and achieve the effect of strong repeatability, small injury and high accuracy

Inactive Publication Date: 2008-12-31
YANGZHOU UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, most of the genomic DNA used in bird sex identification is extracted from blood samples, which is easy to cause harm to animals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sex appraisal process for pigeon for meat

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0011] 1. Extraction of pigeon feather marrow DNA:

[0012] (1) Take 3-5 neck or wing feathers of meat pigeons, cut the terminal feather pith into pieces, put them in a 1.5ml finger tube, add 600μl lysate (50m MTris-HCl, 100Mm EDTA, 100Mm NaCl, 0.5 %SDS, pH 8.0), treated at 37°C for 3h, then added 5 μl proteinase K (20mg / ml), and bathed overnight at 55°C;

[0013] (2) Add an equal volume of Tris saturated phenol, shake gently for 30min, centrifuge at 12000rpm for 10min, and draw the supernatant into a 1.5ml centrifuge tube;

[0014] (3) Add an equal volume of phenol-chloroform-isoamyl alcohol (25:24:1), shake gently for 10 minutes, centrifuge at 12000 rpm for 10 minutes, and draw the supernatant into another clean centrifuge tube;

[0015] (4) Add an equal volume of chloroform-isoamyl alcohol (24:1), shake gently for 10 minutes, centrifuge at 12000 rpm for 10 minutes, and suck the supernatant into another clean centrifuge tube;

[0016] (5) Precipitate DNA with 2.5 times the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

Disclosed is a method for identifying the sex of meat pigeons, which belongs to the molecular biology technique field. Through comparing exon sequences at both ends of introns of CHD genes of jungle fowls and cygnets, exons on two ends thereof are respectively designed with an upstream primer and a downstream primer: Psf: 5`CAAGGATGAGAAACTGTGCAA3`; and Psr: 5`GAATATCTTCTGCTCCTACTG3`; and the Psf / Psr primers are used for amplifying the CHD genes on Z and W chromosomes of meat pigeon feather pulp genome DNA, and finally the sex is identified according to the band type through 10 percent polyacrylamide gel electrophoresis and silver staining, wherein, female shows two bands and male shows one band. The method can identify the sex of birds by only mastering the general PCR technique and polyacrylamide gel electrophoresis and silver staining operations, and has advantages of strong repeatability and high accuracy (100 percent, n=280).

Description

technical field [0001] The invention belongs to the technical field of molecular biology. Background technique [0002] At present, the sex of young pigeons is judged based on experience and methods such as birth weight, comparison of toe lengths, and tank turning, but there is a lack of scientific basis and the accuracy rate is not high. [0003] The CHD gene of birds, that is, the chromosomal helicase-DNA binding gene (chromo-helicase-DNA binding gene) is located on the sex chromosome, and there are two homologous copies CHD-W and CHD-Z in non-ratite birds, wherein CHD-W is W Chain, CHD-Z is Z chain. In most birds, the exons of this gene are highly conserved, while the introns are more mutated between the sexes, so gender identification can be made based on the difference in the length of the introns between males and females. [0004] Since meat pigeon females are of ZW type and males are of ZZ type, the upstream and downstream primers spanning the intron are designed a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 丁家桐郑爱燕孟俊潘孝青王鹏秦志艳刘辉吴曼俞凤燕张舒
Owner YANGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap