Cryptosporidum parvum bivalent nucleic acid vaccine and preparation method thereof

A technology for Cryptosporidium microsporidium and nucleic acid vaccine, which can be applied in the fields of botanical equipment and methods, biochemical equipment and methods, and pharmaceutical formulations, etc. Cellular immunity and humoral immunity, enhancing immune protection, and preventing cryptosporidiosis parvum in animals

Inactive Publication Date: 2009-05-06
JILIN UNIV
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented technology allows creating an improved version of DNA called cryptoptosis by selecting specific proteins from different sources or adding them along with other molecules like enzyme(s) which help stimulate innate defense mechanisms against certain viruses such as cholera virus (CPE). These modifications make it more effective at combatting animal diseases caused due to their ability to produce specialized protein-based components known collectively as necrotrophil gelatinase associated lipoprotein lipocalysaccharide), resulting in increased resistance to attack.

Problems solved by technology

This patented technical problem addressed in this patents relates to how cryptoptosis affecting diseases such as cholera or salmonella spread through animal hosts worldwide despite current treatments like quaternary amine-based agents used against them.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cryptosporidum parvum bivalent nucleic acid vaccine and preparation method thereof
  • Cryptosporidum parvum bivalent nucleic acid vaccine and preparation method thereof
  • Cryptosporidum parvum bivalent nucleic acid vaccine and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Preparation of Bivalent Nucleic Acid Vaccine against Cryptosporidium parvum

[0020] The present invention takes the immune-related protein genes CP12 and CP21 of Cryptosporidium parvum as an example to construct the recombinant eukaryotic expression vector.

[0021] The preparation steps of cryptosporidium parvum bivalent nucleic acid vaccine:

[0022] According to the open reading frames of CP12 and CP21 gene sequences and the physical map of eukaryotic expression vector pVAX1, primers were designed and enzyme cutting sites were introduced.

[0023] CP12 upstream primer:

[0024] QF1: 5'-CT GGATCC TCCATGACGTTCCTGACGTTATGTCAGATGCATCAATA -3'; the 5' end contains a BamHI site and a CPG immune booster sequence;

[0025] Downstream primer QR1: 5'-GGGGC GAATTC TATTTGTTCATTCATCTG-3'; 5' end contains an EcoRI site.

[0026] CP21 upstream primer:

[0027] QF2: 5'-CC GAATTC GGTGGCGGTGGCTCGATGTCTAAAAAGAGCAT-3', the 5' end contains EcoRI site and Linker sequence;

[00...

Embodiment 2

[0031] Application of Cryptosporidium parvum Bivalent Nucleic Acid Vaccine

[0032] Divide 50 4-6 weeks old, 18-22g female clean level BALB / c mice into 5 groups, 10 in each group, wherein the first group is the negative control group (intramuscular injection of 100ul / normal saline), the second Group pVAX1-CPG-CP12-CP21 intramuscular injection group (adjuvant is styrol, 100ug / piece), the third group is pVAX1 intramuscular injection group (adjuvant is stilbene, 100ug / piece), the fourth group is pVAX1- CPG-CP12-CP21, nasal drop group (adjuvant is styrol, 100ug / monkey), the fifth positive control group, intramuscular injection of oocyst antigen 100ug / monkey. Each group received three injections, two weeks apart. Oral inoculation of Cryptosporidium parvum oocysts 1×10 one week after the third immunization 6 Each group / only was used for the challenge test. After the challenge, the feces of each group were collected every two days, and the oocysts were collected by saturated zinc s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a cryptosporidium bivalent DNA vaccine and a preparation method thereof, which use a eucaryon expression carrier pVAX1 as a carrier, and combine two cryptosporidium protective antigen genes and a CPG immune strengthening sequence inserted into a polyclonal site region of the pVAX1 eucaryon expression carrier in series to obtain the cryptosporidium bivalent DNA vaccine containing the immune strengthening sequence. Two protective antigen genes are chosen to carry out the development of the bivalent DNA vaccine, and the CPG immune strengthening sequence is introduced on the basis, thus enhancing the immune protective effect. The vaccine has stronger cell immunity and humoral immunity functions, and the introduced CPG motif has the functions of invigorating the immunity system, inducing the natural immunity response, and secreting immune globulin and various cell factors, and the two are in the superiority combination, thus achieving the aim of better preventing animal cryptosporidium diseases.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
OwnerJILIN UNIV