Cryptosporidum parvum bivalent nucleic acid vaccine and preparation method thereof
A technology for Cryptosporidium microsporidium and nucleic acid vaccine, which can be applied in the fields of botanical equipment and methods, biochemical equipment and methods, and pharmaceutical formulations, etc. Cellular immunity and humoral immunity, enhancing immune protection, and preventing cryptosporidiosis parvum in animals
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Preparation of Bivalent Nucleic Acid Vaccine against Cryptosporidium parvum
[0020] The present invention takes the immune-related protein genes CP12 and CP21 of Cryptosporidium parvum as an example to construct the recombinant eukaryotic expression vector.
[0021] The preparation steps of cryptosporidium parvum bivalent nucleic acid vaccine:
[0022] According to the open reading frames of CP12 and CP21 gene sequences and the physical map of eukaryotic expression vector pVAX1, primers were designed and enzyme cutting sites were introduced.
[0023] CP12 upstream primer:
[0024] QF1: 5'-CT GGATCC TCCATGACGTTCCTGACGTTATGTCAGATGCATCAATA -3'; the 5' end contains a BamHI site and a CPG immune booster sequence;
[0025] Downstream primer QR1: 5'-GGGGC GAATTC TATTTGTTCATTCATCTG-3'; 5' end contains an EcoRI site.
[0026] CP21 upstream primer:
[0027] QF2: 5'-CC GAATTC GGTGGCGGTGGCTCGATGTCTAAAAAGAGCAT-3', the 5' end contains EcoRI site and Linker sequence;
[00...
Embodiment 2
[0031] Application of Cryptosporidium parvum Bivalent Nucleic Acid Vaccine
[0032] Divide 50 4-6 weeks old, 18-22g female clean level BALB / c mice into 5 groups, 10 in each group, wherein the first group is the negative control group (intramuscular injection of 100ul / normal saline), the second Group pVAX1-CPG-CP12-CP21 intramuscular injection group (adjuvant is styrol, 100ug / piece), the third group is pVAX1 intramuscular injection group (adjuvant is stilbene, 100ug / piece), the fourth group is pVAX1- CPG-CP12-CP21, nasal drop group (adjuvant is styrol, 100ug / monkey), the fifth positive control group, intramuscular injection of oocyst antigen 100ug / monkey. Each group received three injections, two weeks apart. Oral inoculation of Cryptosporidium parvum oocysts 1×10 one week after the third immunization 6 Each group / only was used for the challenge test. After the challenge, the feces of each group were collected every two days, and the oocysts were collected by saturated zinc s...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 