Recombinant bacillus calmette guerin vaccine for toxoplamasis and preparation method thereof

A technology of recombinant BCG and Toxoplasma gondii, which is applied in the field of preparation of Toxoplasma recombinant BCG vaccine, can solve the problems of weak anti-infection ability and inapplicability to human beings, and achieve easy transportation and storage, strong humoral immune adjuvant effect, thermal good stability effect

Inactive Publication Date: 2011-09-28
JILIN UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The research on Toxoplasma gondii vaccines has gone through various explorations such as inactivated vaccines and live attenuated vaccines. The former stimulates the body to produce weak anti-infection ability, while the latter can produce a better protective effect, but due to the recovery of virulence after mutation, Therefore, it is not applicable to human beings. Therefore, it is the task of the present invention to adopt a genetic engineering method to develop a kind of efficient and cheap novel toxoplasma vaccine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacillus calmette guerin vaccine for toxoplamasis and preparation method thereof
  • Recombinant bacillus calmette guerin vaccine for toxoplamasis and preparation method thereof
  • Recombinant bacillus calmette guerin vaccine for toxoplamasis and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Preparation of Toxoplasma gondii recombinant BCG vaccine of the present invention

[0026] Taking the protective antigen Cyclophilin gene of Toxoplasma gondii as an example, the shuttle expression vector and the integrated expression vector were constructed.

[0027] 1. The preparation steps of the recombinant BCG vaccine of the shuttle expression vector Toxoplasma gondii:

[0028] According to the Cyclophilin gene DNA sequence and the physical map of the shuttle vector pMV261, two pairs of primers were designed and restriction restriction sites were introduced.

[0029] Upstream primer QF1: 5'- GAATTCATGAAGCTCGTGCTGTTTTTCCT -3'; the 5' end contains an EcoRI site;

[0030] Downstream primer QR: 5'- GTCGACTTACTCCAACAAACCAATGTCCGT -3'; the 5' end contains a SalI site.

[0031] The PCR purified product was cloned into the pMD18-T vector and identified by PCR, enzyme digestion and sequencing. The fragment recovered from the gel was ligated with the shuttle expression vect...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a recombinant bacillus calmette guerin (BCG) vaccine for toxoplamasis and a preparation method thereof. The preparation method for the recombinant bacillus calmette guerin vaccine comprises the following steps of: performing target (TA) cloning on an obtained toxoplasma gondii cyclophilin gene; sequencing and identifying correctly, performing enzyme cutting and recovering target fragments; connecting the target fragments with an Escherichia coli-mycobacterium shuttle expression vector pMV261 and an integrated expression vector pMV361 which are subjected to enzyme cutting reaction respectively; and converting recombinant plasmids to BCG, and screening by resistance and polymerase chain reaction (PCR) to obtain the recombinant bacillus calmette guerin vaccine for the positive toxoplasma gondii. The vaccine is high in heat stability and easy to transport, store and produce, is not needed to be purified and can be directly used for immune protection tests, and a complex process of protein aftertreatment is avoided, so the cost is reduced greatly, and the recombinant bacillus calmette guerin vaccine is suitable for vast rural areas.

Description

technical field [0001] The invention provides a recombinant BCG vaccine for toxoplasma gondii, which is used for the prevention and treatment of toxoplasmosis. The invention also provides a preparation method of the vaccine, which belongs to the technical field of vaccine preparation. Background technique [0002] Toxoplasmosis (Toxoplasmosis) is caused by Toxoplasma gondii, a worldwide widespread zoonotic disease, because of its wide range of hosts, it can infect humans and most animals. Toxoplasma gondii infection is a serious hazard to animal husbandry production, mainly causing miscarriage, teratogenicity, stillbirth and so on. The harm of Toxoplasma gondii is huge, but the prevention and treatment of this disease has not yet found an ideal drug. Although antiparasitic drugs are highly effective, cheap and easy to administer, the emergence of drug resistance in Toxoplasma gondii and the general concern of drug residues are increasing. In comparison, vaccines are relati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K39/005C12N15/74A61P33/02C12R1/32
Inventor李建华张西臣于钦磊宫鹏涛张国才杨举张楠李赫张倩
OwnerJILIN UNIV