Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A recombinant bacillus calmette-guerin vaccine used for preventing toxoplasmosis in pigs and a preparing method thereof

A technology for recombinant BCG and toxoplasmosis, which is applied in the field of vaccines, can solve problems such as unsatisfactory immune effects of vaccines, and achieve the effects of good immune protection, prevention of toxoplasmosis, and stability and safety.

Inactive Publication Date: 2016-10-26
JILIN UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The research on toxoplasmosis vaccine has developed from the earliest whole worm vaccine to nucleic acid vaccine. Due to the complex life history and various transmission routes of Toxoplasma gondii, the immune effect of various vaccines is not ideal.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A recombinant bacillus calmette-guerin vaccine used for preventing toxoplasmosis in pigs and a preparing method thereof
  • A recombinant bacillus calmette-guerin vaccine used for preventing toxoplasmosis in pigs and a preparing method thereof
  • A recombinant bacillus calmette-guerin vaccine used for preventing toxoplasmosis in pigs and a preparing method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] 1. Preparation and evaluation of recombinant BCG vaccine for porcine toxoplasmosis prevention with shuttle expression vector:

[0033] (1) Preparation steps of pMV261-IL2-Rho recombinant BCG vaccine for preventing porcine toxoplasmosis:

[0034] 1. Primer design

[0035] According to the DNA sequence of porcine interleukin 2 (IL-2) gene, the DNA sequence of Toxoplasma gondii Rhomboid gene and the vector map of shuttle vector pMV261, 2 pairs of primers were designed and restriction sites were introduced.

[0036] Porcine interleukin 2 (IL-2) upstream primer IL-F: 5'CG GAATTC ATGTATAAGATGCAGCTC 3', where the restriction site at the 5' end is Eco RI.

[0037] Downstream primer IL-R: 5'CGC GGATCC AGTCAGTGTTGAGTAGATGCTTTG3', wherein the restriction site at the 5' end is Bam Hi.

[0038] The upstream primer of Toxoplasma gondii Rhomboid gene is R-F: 5'CGC GGATCC ATGCCTATTCGCTTTCTCG 3', the restriction site at the 5' end is Bam Hi.

[0039] Downstream primer R-R:...

Embodiment 2

[0074] 2. The preparation and evaluation effect of recombinant BCG vaccine integrated with expression vector for porcine toxoplasmosis prevention:

[0075] (1) Preparation steps of pMV361-IL2-Rho recombinant BCG for preventing porcine toxoplasmosis:

[0076] 1. Primer design

[0077] According to the DNA sequence of porcine interleukin 2 (IL-2) gene, the DNA sequence of Toxoplasma gondii Rhomboid gene and the vector map of shuttle vector pMV361, 2 pairs of primers were designed and restriction sites were introduced.

[0078] Porcine interleukin 2 (IL-2) upstream primer IL-F: 5'CG GAATTC ATGTATAAGATGCAGCTC 3', where the restriction site at the 5' end is Eco RI.

[0079] Downstream primer IL-R: 5'CGC GGATCC AGTCAGTGTTGAGTAGATGCTTTG3', wherein the restriction site at the 5' end is Bam Hi.

[0080] The upstream primer of Toxoplasma gondii Rhomboid gene is R-F: 5'CGC GGATCC ATGCCTATTCGCTTTCTCG 3', the restriction site at the 5' end is Bam Hi.

[0081] Downstream primer ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A recombinant bacillus calmette-guerin vaccine used for preventing toxoplasmosis in pigs is disclosed. A preparing method of the vaccine is also provided. The characteristic that a bacillus calmette-guerin living-vector vaccine has strong cell immunity and body fluid immunity adjuvant functions is utilized, an exogenous protein can be expressed efficiently so that the expressed protein can exert good immunity protection functions, and the above two advantages are combined to achieve the objective of preventing toxoplasmosis. The recombinant BCG vaccine combines an adjuvant and the vector, and integrates a plurality of exogenous genes and a live vaccine. Strong and durable specific immunity can be obtained through one time of inoculation of the recombinant BCG vaccine. The recombinant BCG vaccine is stable, high in safety and easy in transportation and storage.

Description

technical field [0001] The invention belongs to the technical field of vaccines and discloses a recombinant BCG vaccine for preventing porcine toxoplasmosis. The invention also provides a preparation method of the vaccine. Background technique [0002] Toxoplasma gondii is an obligate intracellular parasitic protozoan distributed worldwide, which can invade the nucleated cells of various animals (such as: pigs, cattle, sheep, etc.) and humans, leading to toxoplasma infection or toxoplasmosis. Animals infected with Toxoplasma gondii can easily cause animal growth, production performance decline, immunity decrease, fecundity decrease, and severe cases cause animal death. Pigs infected with toxoplasmosis can cause a large number of deaths, and pregnant female animals infected with toxoplasmosis can cause abortion. Due to the complex life cycle and various transmission routes of Toxoplasma gondii, there is no ideal drug for the prevention and control of toxoplasmosis. Therefor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/74C12N1/21A61K39/002A61K39/39A61P33/02C12R1/32
CPCA61K39/002A61K39/39C12N9/6405C12N15/74C07K14/55C12N2800/101A61K2039/55533A61K2039/575A61K2039/53A61K2039/523
Inventor 宫鹏涛张西臣信彩岩于晓娜李建华王伟荣李显赫杨举李赫李棕松
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com