Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleotide sequence for preventing sheep toxoplasmosis infection, vector, protein, vaccine, preparation method and application thereof

A nucleotide sequence, Toxoplasma gondii technology, applied in the fields of immunology and biology, can solve the problems of inability to widely use attenuated vaccines, reversion of virulence, insufficient attenuation, etc., and achieve strong cellular immunity and humoral immunity. The effect of preventing toxoplasmosis

Inactive Publication Date: 2017-02-15
AIKAN BIOTECH TIANJIN CO LTD
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Whole insect vaccines include inactivated vaccines and live attenuated vaccines, but inactivated vaccines lack immune protection for mice, so they have no practical application value; Toxoplasma gondii tachyzoites are weakened after being treated with ultraviolet rays, radiation and chemical reagents. Can induce a strong immune response, such as Ts-4, T-263 and S48, but attenuated live vaccines have risks such as insufficient attenuation and virulence reversion, so attenuated vaccines cannot be widely used; subunit vaccines are derived from insects Specific components are extracted from body lysates or excretion-secretion antigens as vaccines, which have good immunogenicity, but purification is time-consuming, laborious, and expensive; genetic engineering vaccines express Toxoplasma gondii antigen genes in high-efficiency expression vectors, resulting in large quantities of purified single antigens

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleotide sequence for preventing sheep toxoplasmosis infection, vector, protein, vaccine, preparation method and application thereof
  • Nucleotide sequence for preventing sheep toxoplasmosis infection, vector, protein, vaccine, preparation method and application thereof
  • Nucleotide sequence for preventing sheep toxoplasmosis infection, vector, protein, vaccine, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1: Construction of the prokaryotic expression vector of Toxoplasma gondii recombinant protein

[0033] According to the open reading frame of the Toxoplasma gondii HMG1 gene sequence and the physical map of the prokaryotic expression vector pET28a, primers were designed and enzyme cutting sites were introduced.

[0034] Upstream: G GAATTC GCACCGAAGAAGGTGACAAAGAAG

[0035] Downstream: CC CTCGAG TTTCTTCTTGTTGTAGAGAGAG

[0036] Use the RNA extraction kit to extract the total RNA of Toxoplasma trophozoites, and use the RT-PCR kit to amplify the HMG1 gene (the general RT parameters are: 37°C for 60min; 65°C for 20min; 4°C for 5min. The PCR parameters are: 95°C for 3min; 94°C 1min; 59.5°C for 40s, 72°C for 1min, and after 30 cycles of extension at 72°C for 10min), the PCR purified product was cloned into pGEM-T vectorsystem. Positive clones were identified by enzyme digestion and sequencing, and the positive plasmids were double-enzymeed by EcoRI and XhoI Aft...

Embodiment 2

[0037] Embodiment 2: Purification of expressed protein

[0038] (1) Extraction and solubility verification of expressed protein

[0039] A single colony of E.coli BL21(DE3) transformed with the recombinant plasmid pET-28a(+)-HMG1 was selected as the starting strain, inoculated in 8 mL LB liquid medium, and cultured overnight at 37°C with shaking. The next day, the seed solution was transferred to 400mL LB liquid medium for multiplication at 37°C, and the expression was induced under optimal conditions when the OD600 of the bacterial solution was monitored to 0.6-0.7. Collect the bacteria by centrifugation, suspend the bacteria with 10mL soluble protein lysate, add 100μL 0.1M PMSF, freeze and thaw 3 times (-80℃, 1h / 37℃, 10min), after sonication, or add 100μL DNase and 100μL 100× DNase Buffer and 100μL RNase, in a water bath at 37°C for 15 minutes, centrifuge to get the supernatant, which is the soluble protein (active protein). Suspend the precipitate with 10 mL of insoluble ...

Embodiment 3

[0042] Example 3: Detection of the immunogenicity of expression products to mouse macrophages

[0043] RAW264.7 cells were seeded on 24-well culture plates at 0.5x106 / mL, 1 mL per well, 5% CO2, and cultured at 37°C for 24 hours. After aspirating the supernatant, dissolve the prepared Toxoplasma gondii recombinant HMG1 protein in the RAW264.7 cell culture medium, and add it to the cell culture plate at a concentration of 1 μg / mL, 0.1 μg / mL, and 0.01 μg / mL at 1 mL / well In the experiment, an equal volume of blank plasmid-purified protein NR was used as a negative control. The cell culture plate was placed in 5% CO2, cultured in a 37°C incubator for 48 hours, the supernatant was collected, and the level of TNF-a was detected by ELISA experiment. The results show that the production of TNF-a is different, and the amount of TNF-a increases with the increase of protein concentration, ranging from 180pg-520pg, the results are shown in the appendix Figure 4 ; The results show that t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a nucleotide sequence for preventing sheep toxoplasmosis infection, a vector, a protein, a vaccine, a preparation method and application thereof. The nucleotide sequence comprises the following nucleotide sequences: (1) nucleotide sequence shown in SEQ ID NO.1; (2) nucleotide sequence which is complementary to the nucleotide sequence shown in (1); and (3) nucleotide sequence obtained by subjecting the nucleotide sequence in the (1) or (2) to replacing, deleting and adding and modifying of one or several base groups. The invention also provides the vaccine which is prepared by that toxoplasma antigen is subjected to double-enzyme digestion and then is connected with a pET28a expression vector, and then is transformed into a BL21 (DE3) engineering bacteria, high-efficiency expression is induced, the expression product is purified to obtain soluble proteins, and finally the soluble proteins are added with 206 adjuvant to obtain the vaccine. The prepared subunit inactivated vaccine has relatively strong cell immunity and humoral immunity effect, the congenital immune response of the body can be induced, various cell inflammatory factors are secreted, and therefore the toxoplasmosis is effectively prevented.

Description

technical field [0001] The present invention relates to the fields of immunology and biology, and relates to a subunit inactivated vaccine for preventing Toxoplasma gondii infection, a preparation method and its application, and mainly relates to a nucleotide sequence for preventing Toxoplasma gondii infection, Vectors, proteins, vaccines and preparation methods and their applications. Background technique [0002] Toxoplasmosis is a worldwide zoonotic parasitic disease caused by Toxoplasma gondii. Toxoplasmosis has become one of the important public health problems to be solved urgently in my country. The reasons are mainly reflected in the following points: 1. The infection rate of human Toxoplasma gondii is extremely high, generally 20% to 50%, up to 94%. One-third of people are infected with Toxoplasma gondii, and the infection rate of Toxoplasma gondii among Chinese population is 5% to 20%. Toxoplasma gondii infection in pregnant women can affect the development of the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/45C12N15/30C07K19/00C12N15/70A61K39/002A61K48/00A61P33/02C12R1/19
CPCC07K14/45A61K39/002A61K48/00C07K2319/21
Inventor 侯峰曹利利陈星远王典李思明杨阳
Owner AIKAN BIOTECH TIANJIN CO LTD