Molecular markers for avirulence gene Avr-Pit of Pyricularia grisea

The technology of avr-pit and rice blast fungus is applied in the field of molecular markers for detecting the avirulent gene Avr-Pit of rice blast fungus, which can solve the problems of inconvenient avirulent genotoxicity composition analysis, complex operation procedures of biochemical reagents, and the like, and achieve accuracy Low, clear results, time-saving effect

Inactive Publication Date: 2013-11-06
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Some nontoxic gene-linked molecular markers (especially molecular markers used in early positioning) are mostly RFLP markers, but because such markers require complex operating procedures, expensive biochemical reagents, and DNA from a large number of samples, it is not convenient for the detection of nontoxic genes. Toxic component analysis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular markers for avirulence gene Avr-Pit of Pyricularia grisea
  • Molecular markers for avirulence gene Avr-Pit of Pyricularia grisea
  • Molecular markers for avirulence gene Avr-Pit of Pyricularia grisea

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] The molecular markers and positioning of the Avr-Pit linkage of the rice blast fungus avirulence gene are obtained by the following methods:

[0025]1) Using the parents Guy11 and JS153 (the parent strain is a strain preserved in the Department of Plant Diseases of Nanjing Agricultural University) and the sexual offspring obtained from the hybridization (identified by Chen Qinghe, etc.), in the initially obtained SSR marker m355 linked to the avirulent gene Avr-Pit -356 based on (Chen QH, Wang YC, Li AN, Zhang ZG, Zheng XB.2007.Molecular mapping of two cultivar-specific avirulence genes in the rice blast fungus Magnaporthe grisea.Mol Genet Genomics.277(2):139- 48.), design CAPS marker primers, the primer sequences are shown in Table 1:

[0026] Table 1

[0027]

[0028] 2) The molecular markers amplified by two pairs of CAPS molecular marker primers containing CAPS markers CAPS77 and CAPS88 were screened for markers linked to the avirulent gene Avr-Pit in the two pa...

Embodiment 2

[0031] The primers CAPS77 and CAPS88 in Example 1 were amplified in 65 offspring, and the PCR reaction system and program were the same as in Example 1. After the reaction was finished, 50 μl of each sample was placed on 1% agarose gel in 1×TAE ( Electrophoresis in 10mM Tris, pH7.8, 5mM sodium acetate, 0.5mM EDTA), and then soak the amplified product in a solution containing ethidium bromide (0.5μg / ml) for 10-15min, then move to clean water and rinse for 5- 10min, observed under ultraviolet light and photographed with Bio-rad gel imaging system. The fragments were recovered, digested with the corresponding enzymes EarI and PciI, and the results were observed by electrophoresis after 10 hours. If two fragments of 268bp and 101bp are produced by digestion with the enzyme EarI, the genome of the rice blast fungus to be tested contains the avirulent gene Avr-Pit; if two fragments of 472bp and 382bp are produced by digestion with the enzyme PciI The fragment of the blast pathogen ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for quickly and accurately detecting an avirulence gene Avr-Pit of Pyricularia grisea by using molecular markers. According to the method, two pairs of specific primers are utilized, wherein an upstream primer of one pair of primers is ACCGCGATCAGTGGAAAACT, and a downstream primer is ATTGGCAGAGCCAGCTACTC; and an upstream primer of the other pair of primers is TTGTGTTCCTGTCAATCGCG, and a downstream primer is CGCAGCTTATATCTCGGATAG. The method is easy to operate; results are definite; and the time and cost are saved.

Description

technical field [0001] The invention relates to a molecular marker primer for detecting the rice blast fungus avirulent gene Avr-Pit, and a molecular marker method for detecting the rice blast fungus avirulent gene Avr-Pit using the primer. Background technique [0002] Rice is one of the important food crops, and rice blast is one of the most widely distributed and most serious rice diseases in the world, and has become a major obstacle to high and stable rice yields (Ou S H.1980, Pathogen variability and host resistance in rice blast disease.Ann Rev Phytopathol.18:167-187.), the harm it causes is seriously threatening human food security. The control of rice blast is the same as other rice diseases, through the use of fungicides, cultivation measures and the combination of planting disease-resistant varieties, and planting disease-resistant varieties is one of the most economical and effective ways to control rice blast. However, in order to effectively carry out disease-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
Inventor张正光董妍涵王源超郑小波董莎萌
OwnerNANJING AGRICULTURAL UNIVERSITY